EP1736554B1 - Detection of nucleic acid sequence differences using coupled ligase detection and polymerase chain reactions - Google Patents

Detection of nucleic acid sequence differences using coupled ligase detection and polymerase chain reactions Download PDF

Info

Publication number
EP1736554B1
EP1736554B1 EP06011667.0A EP06011667A EP1736554B1 EP 1736554 B1 EP1736554 B1 EP 1736554B1 EP 06011667 A EP06011667 A EP 06011667A EP 1736554 B1 EP1736554 B1 EP 1736554B1
Authority
EP
European Patent Office
Prior art keywords
primary
primer
polymerase chain
chain reaction
pcr
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime
Application number
EP06011667.0A
Other languages
German (de)
French (fr)
Other versions
EP1736554A3 (en
EP1736554A2 (en
Inventor
Phillip Belgrader
Francis Barany
Matthew Lubin
George Barany
Robert P. Hammer
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Cornell Research Foundation Inc
Original Assignee
Cornell Research Foundation Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=21788414&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=EP1736554(B1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Application filed by Cornell Research Foundation Inc filed Critical Cornell Research Foundation Inc
Priority to EP10075461.3A priority Critical patent/EP2369007B1/en
Publication of EP1736554A2 publication Critical patent/EP1736554A2/en
Publication of EP1736554A3 publication Critical patent/EP1736554A3/en
Application granted granted Critical
Publication of EP1736554B1 publication Critical patent/EP1736554B1/en
Anticipated expiration legal-status Critical
Expired - Lifetime legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6827Hybridisation assays for detection of mutation or polymorphism
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6827Hybridisation assays for detection of mutation or polymorphism
    • C12Q1/683Hybridisation assays for detection of mutation or polymorphism involving restriction enzymes, e.g. restriction fragment length polymorphism [RFLP]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6851Quantitative amplification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6853Nucleic acid amplification reactions using modified primers or templates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6858Allele-specific amplification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/686Polymerase chain reaction [PCR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6862Ligase chain reaction [LCR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869Methods for sequencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6881Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for tissue or cell typing, e.g. human leukocyte antigen [HLA] probes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/16Primer sets for multiplex assays

Definitions

  • the present invention relates to the detection of nucleic acid sequence differences using coupled polymerase chain reaction ("PCR").
  • PCR coupled polymerase chain reaction
  • the present invention involves a primary polymerase chain reaction coupled to a secondary polymerase chain reaction, as set out in the claims.
  • a variety of DNA hybridization techniques are available for detecting the presence of one or more selected polynucleotide sequences in a sample containing a large number of sequence regions.
  • a fragment containing a selected sequence is captured by hybridization to an immobilized probe.
  • the captured fragment can be labeled by hybridization to a second probe which contains a detectable reporter moiety.
  • Another widely used method is Southern blotting.
  • a mixture of DNA fragments in a sample is fractionated by gel electrophoresis, then fixed on a nitrocellulose filter.
  • the filter By reacting the filter with one or more labeled probes under hybridization conditions, the presence of bands containing the probe sequences can be identified.
  • the method is especially useful for identifying fragments in a restriction-enzyme DNA digest which contains a given probe sequence and for analyzing restriction-fragment length polymorphisms ("RFLPs").
  • Another approach to detecting the presence of a given sequence or sequences in a polynucleotide sample involves selective amplification of the sequence(s) by polymerase chain reaction.
  • primers complementary to opposite end portions of the selected sequence(s) are used to promote, in conjunction with thermal cycling, successive rounds of primer-initiated replication.
  • the amplified sequence(s) may be readily identified by a variety of techniques. This approach is particularly useful for detecting the presence of low-copy sequences in a polynucleotide-containing sample, e.g., for detecting pathogen sequences in a body-fluid sample.
  • the confronting ends of the probe elements can be joined by ligation, e.g., by treatment with ligase.
  • the ligated probe element is then assayed, evidencing the presence of the target sequence.
  • the ligated probe elements act as a template for a pair of complementary probe elements.
  • the target sequence is amplified linearly, allowing very small amounts of target sequence to be detected and/or amplified.
  • This approach is referred to as ligase detection reaction.
  • the process is referred to as the ligase chain reaction which achieves exponential amplification of target sequences.
  • Jou, et. al., "Deletion Detection in Dystrophia Gene by Multiplex Gap Ligase Chain Reaction and Immunochromatographic Strip Technology," Human Mutation 5:86-93 (1995 ) relates to the use of a so called “gap ligase chain reaction” process to amplify simultaneously selected regions of multiple exons with the amplified products being read on an immunochromatographic strip having antibodies specific to the different haptens on the probes for each exon.
  • Solid-phase hybridization assays require multiple liquid-handling steps, and some incubation and wash temperatures must be carefully controlled to keep the stringency needed for single-nucleotide mismatch discrimination. Multiplexing of this approach has proven difficult as optimal hybridization conditions vary greatly among probe sequences.
  • Allele-specific PCR products generally have the same size, and an assay result is scored by the presence or absence of the product band(s) in the gel lane associated with each reaction tube.
  • PCR has also discriminated alleles by attaching different fluorescent dyes to competing allelic primers in a single reaction tube ( F.F. Chehab, et al., Proc. Natl. Acad. Sci.
  • Ligation of allele-specific probes generally has used solid-phase capture ( U. Landegren et al., Science, 241:1077-1080 (1988 ); Nickerson et al., Proc. Natl. Acad. Sci. USA, 87:8923-8927 (1990 )) or size-dependent separation ( D.Y. Wu, et al., Genomics, 4:560-569 (1989 ) and F. Barany, Proc. Natl. Acad. Sci., 88:189-193 (1991 )) to resolve the allelic signals, the latter method being limited in multiplex scale by the narrow size range of ligation probes.
  • the ligase detection reaction alone cannot make enough product to detect and quantify small amounts of target sequences.
  • the gap ligase chain reaction process requires an additional step - polymerase extension.
  • the use of probes with distinctive ratios of charge/translational frictional drag for a more complex multiplex will either require longer electrophoresis times or the use of an alternate form of detection.
  • Tandem repeat DNA sequences known as microsatellites represent a very common and highly polymorphic class of genetic elements within the human genome. These microsatellite markers containing small repeat sequences have been used for primary gene mapping and linkage analysis. Weber, J.L. et al., Am. J. Hum. Genet. 44: 388-396 (1989 ); Weissenbach, J. et al., Nature (London) 359: 794-800 (1992 ). PCR amplification of these repeats allows rapid assessment for loss of heterozygosity and can greatly simplify procedures for mapping tumor suppressor genes. Ruppert, J.M., et al., Cancer Res. 53: 5093-94 (1993 ); van der Riet, et al., Cancer Res.
  • PCR is commonly used for microsatellite analysis in identifying both the appearance of new polymorphisms and the loss of heterozygosity in cancer detection.
  • L. Mao, et. al. "Microsatellite Alterations as Clonal Markers for the Detection of Human Cancer," Proc. Nat'l Acad. Sci USA 91(21): 9871-75 (1994 );
  • L. Mao, et. al. "Molecular Detection of Primary Bladder Cancer by Microsatellite Analysis," Science 271:659-62 (1996 ); D. Radford, et.
  • Microsatellite markers have also been used for colon cancer detection ( L. Cawkwell, et. al., "Frequency of Allele Loss of DCC, p53, RB1, WTl, NF1, NM23, and APC/MCC in Colorectal Cancer Assayed by Fluorescent Multiplex Polymerase Chain Reaction," Br. J. Cancer 70(5): 813-18 (1994 )) and for genome mapping ( P. Reed, et. al., “Chromosome-specific Microsatellite Sets for Fluorescent-Based, Semi-Automated Genome Mapping," Nat. Genet. 7(3): 390-95 (1994 )).
  • the key to such multiplex processes is the ability to perform them in a single reaction tube.
  • PCR has also been used for human identification, such as paternity testing, criminal investigations, and military personnel identification.
  • A. Syvanen et. al. "Identification of Individuals by Analysis of Biallelic DNA Markers, Using PCR and Solid-Phase Mini-Sequencing" Am. J. Hum. Genet. 52(1): 46-59 (1993 ) describes a mini-sequencing approach to human identification. The technique requires PCR amplification of individual markers with at most 4 PCR reactions being carried out at a time in a single PCR tube. Mini-sequencing is carried out to determine individual polymorphisms.
  • US Patent No. 5,512,441 discloses a quantitative method for early detection of mutant alleles and diagnostic kits for carrying out the method.
  • WO 96/15271 describes a multiplex ligations-dependent amplification process.
  • the present invention is directed to the detection of nucleic acid sequence differences using coupled PCR processes.
  • the present invention can be carried out using primary PCR coupled to secondary PCR as set out in the claims. This requires the use of coupled reactions for multiplex detection of nucleic acid sequence differences where oligonucleotides from an early phase of each process contain sequences which may be used by oligonucleotides from a later phase of the process.
  • the present invention involves a method for identifying two or more of a plurality of sequences differing by one or more insertions or deletions, in a plurality of target nucleotide sequences as set out in the claims. This method involves subjecting a sample potentially containing one or more target nucleotide sequences with a plurality of sequence differences to two successive polymerase chain reaction phases.
  • each group comprises two or more primary oligonucleotide primer sets.
  • Each set has a first oligonucleotide primer, having a target-specific portion and a 5' upstream secondary primary-specific portion, and a second oligonucleotide primer, having a target-specific portion and a 5' upstream secondary primer-specific portion.
  • the first oligonucleotide primers of each set in the same group contain the same 5' upstream secondary primer-specific portion and the second oligonucleotide primers of each set in the same group contain the same 5' upstream secondary primer-specific portion.
  • the oligonucleotide primers in a particular set are suitable for hybridization on complementary strands of a corresponding target nucleotide sequence to permit formation of a polymerase chain reaction product. However, there is a mismatch which interferes with formation of such a polymerase chain reaction product when the primary oligonucleotide primers hybridize to any other nucleotide sequence present in the sample. As set out in the claims, the polymerase chain reaction products in a particular set may be distinguished from other polymerase chain reaction products with the same group or other groups.
  • the primary oligonucleotide primers are blended with the sample and the polymerase to form a primary polymerase chain reaction mixture.
  • the primary polymerase chain reaction mixture is subjected to two or more polymerase chain reaction cycles involving a denaturation treatment, a hybridization treatment, and an extension treatment, as described above.
  • a denaturation treatment a denaturation treatment
  • a hybridization treatment a hybridization treatment
  • an extension treatment a polymerase chain reaction cycle involving a denaturation treatment, a hybridization treatment, and an extension treatment, as described above.
  • the target-specific portion of a primary oligonucleotide primer is hybridized to the target nucleotide sequences.
  • the extension treatment the hybridized primary oligonucleotide primers are extended to form primary extension products complementary to the target nucleotide sequence to which the primary oligonucleotide primer is hybridized, as set out in the claims.
  • the upstream secondary primer-specific portions of a primary oligonucleotide primer set are not present on the target DNA, their sequences are copied by the second and subsequent cycles of the primary polymerase chain reaction phase.
  • the primary extension products produced after the second and subsequent cycles have the secondary primer-specific portions of their 5' ends and the complement of primer-specific portion on the 3' ends.
  • each set has a first secondary primer having a detectable reporter label and containing the same sequence as the 5' upstream portion of a first primary oligonucleotide primer, and a second secondary primer containing the same sequence as the 5' upstream primer of the second primary oligonucleotide primer from the same primary oligonucleotide primer set as the first primary oligonucleotide sequence contained by the first secondary primer.
  • a set of secondary oligonucleotide primers amplify the primary extension products in a given group.
  • the secondary oligonucleotide primers are blended with the primary extension products and the polymerase to form a secondary polymerase chain reaction mixture.
  • the secondary polymerase chain reaction mixture is subjected to one or more polymerase chain reaction cycles involving a denaturation treatment, a hybridization treatment, and an extension treatment, as described above.
  • the hybridization treatment the secondary oligonucleotide primers are hybridized to the primary extension products, while the extension treatment causes the hybridized secondary oligonucleotide primers to be extended to form secondary extension products complementary to the primary extension products as set out in the claims.
  • the labelled secondary extension products are detected as set out in the claims. This indicates the presence of one or more target nucleotide sequences in the sample.
  • the primary PCR/secondary PCR process of the present invention provides significant advantages over Southern hybridization, competitive PCR, and microsatellite marker analysis in detecting nucleotide deletions which cause a loss of heterozygosity.
  • Southern hybridization is more accurate than competitive PCR, it is quite labor intensive, requires large amounts of DNA, and neither technique can be multiplexed.
  • Current multiplex microsatellite marker approaches require careful attention to primer concentrations and amplification conditions.
  • the primary PCR/secondary PCR process of the present invention overcomes these difficulties encountered in the prior art.
  • the primary oligonucleotide primers flank dinucleotide or other repeat sequences and include a secondary primer-specific portion.
  • the primary PCR phase is carried out at low concentrations of these primers to allow several loci to undergo amplification at the same time.
  • the secondary PCR phase causes amplification to continue at the same rate with target-specific secondary primers being selected to space one set of microsatellite markers from the adjacent set.
  • the primary PCR/secondary PCR process can be used to carry out multiplex detection in a single PCR tube and with single gel lane analysis.
  • the present invention is useful in carrying out a microsatellite marker analysis to identify nucleotide deletions in a gene. Such multiplex detection can be carried out in a single reaction tube.
  • the primary PCR/secondary PCR process cannot distinguish amplifications from deletions, so, when making such distinctions, this process must be used in conjunction with the described LDR/PCR process or a differential PCR process.
  • the invention involves a method for identifying two or more of a plurality of sequences differing by one or more, insertions or, deletions in a plurality of target nucleotide sequences as set out in the claims. This method involves subjecting a sample potentially containing one or more target nucleotide sequences with a plurality of sequence differences to two successive polymerase chain reaction phases.
  • each group comprises more than one primary oligonucleotide primer sets.
  • Each set has a first oligonucleotide primer, having a target-specific portion and a 5' upstream secondary primary-specific portion, and a second oligonucleotide primer, having a target-specific portion and a 5' upstream secondary primer-specific portion.
  • the first oligonucloetide primers of each set in the same group contain the same 5' upstream secondary primer-specific portion and the second oligonucleotide primers of each set in the same group contain the same 5' upstream secondary primer-specific portion.
  • the oligonucleotide primers in a particular set are suitable for hybridization on complementary strands of a corresponding target nucleotide sequence to permit formation of a polymerase chain reaction product. However, there is a mismatch which interferes with formation of such a polymerase chain reaction product when the primary oligonucleotide primers hybridize to any other nucleotide sequence present in the sample. As set out in the claims, the polymerase chain reaction products in a particular set may be distinguished from other polymerase chain reaction products with the same group or other groups.
  • the primary oligonucleotide primers are blended with the sample and the polymerase to form a primary polymerase chain reaction mixture.
  • the primary polymerase chain reaction mixture is subjected to two or more polymerase chain reaction cycles involving a denaturation treatment, a hybridization treatment, and an extension treatment, as described above.
  • a denaturation treatment a denaturation treatment
  • a hybridization treatment a hybridization treatment
  • an extension treatment a polymerase chain reaction cycle involving a denaturation treatment, a hybridization treatment, and an extension treatment, as described above.
  • the target-specific portion of a primary oligonucleotide primer is hybridized to the target nucleotide sequences.
  • the extension treatment the hybridized primary oligonucleotide primers are extended to form primary extension products complementary to the target nucleotide sequence to which the primary oligonucleotide primer is hybridized.
  • the upstream secondary primer-specific portions of a primary oligonucleotide primer set are not present on the target DNA, their sequences are copied by the second and subsequent cycles of the primary polymerase chain reaction phase. As a result, the primary extension products produced after the second cycle have the secondary primer-specific portions on their 5' ends and the complement of primer-specific portion on their 3' ends.
  • each set has a first secondary primer having a detectable reporter label and containing the same sequence as the 5' upstream portion of a first primary oligonucleotide primer, and a second secondary primer containing the same sequence as the 5' upstream primer of the second primary oligonucleotide primer from the same primary oligonucleotide primer set as the first primary oligonucleotide sequence contained by the first secondary primer.
  • a set of secondary oligonucleotide primers amplify the primary extension products in a given group.
  • the secondary oligonucleotide primers are blended with the primary extension products and the polymerase to form a secondary polymerase chain reaction mixture.
  • the secondary polymerase chain reaction mixture is subjected to one or more polymerase chain reaction cycles involving a denaturation treatment, a hybridization treatment, and an extension treatment, as described above.
  • the hybridization treatment the secondary oligonucleotide primers are hybridized to the primary extension products, while the extension treatment causes the hybridized secondary oligonucleotide primers to be extended to form secondary extension products complementary to the primary extension products.
  • the labelled secondary extension products are detected. This indicates the presence of one or more target nucleotide sequences in the sample.
  • FIG 22 is a flow diagram depicting a primary PCR/secondary PCR process, in accordance with the present invention, for detection of microsatellite repeats.
  • step 1 i.e. the primary PCR phase
  • step 2 involves a secondary PCR phase where Taq polymerase is used to amplify the primary PCR extension products with oligonucleotide primers containing the same sequence as the secondary primer-specific portion of the primary PCR primers.
  • the extension products resulting from the secondary PCR phase are subjected in step 3 to capillary electrophoresis or gel electrophoresis, followed by fluorescent quantification.
  • the electrophoresis results in Figure 22 indicate the presence of both alleles (i.e., chromosomes) containing RB1 and NM23 and loss of heterozygosity (i.e., loss of allele on one chromosome) for p53.
  • FIG 23 is a schematic diagram depicting a primary PCR/secondary PCR process, according to the present invention, for detection of the loss of heterozygosity due to insertions and deletions in microsatellite repeats.
  • the primary PCR phase in step 1 is initiated by denaturing the sample DNA at 94°C.
  • Long PCR oligonucleotide primers, having 3' ends complementary to unique DNA surrounding microsatellite repeat sequences and 5' ends containing the same sequence as one of two primers utilized in the secondary PCR phase, are then caused to anneal to target DNA at 65°C.
  • the primary PCR phase is carried out for 10-15 cycles.
  • the long primers utilized in the primary PCR phase can be multiplexed as long as they do not amplify alleles with overlapping length ranges. These reactions must be carried out on tumor and corresponding normal DNA to identify informative (i.e. heterozygous) loci.
  • step 2 i.e. secondary PCR amplification
  • primers containing the 5' ends of the primary PCR primers are then used to amplify the primary PCR extension products at nearly equal efficiency.
  • the secondary PCR extension products are then separated and analyzed by gel electrophoresis and an Applied Biosystems Inc. 373A DNA Sequencer using the Genescan 672 software package. Areas of loss of heterozygosity at informative loci are identified.
  • the ligase detection reaction is described generally in WO 90/17239 to Barany et al ., F. Barany et al., "Cloning, Overexpression and Nucleotide Sequence of a Thermostable DNA Ligase-encoding Gene," Gene, 109:1-11 (1991 ), and F. Barany, “Genetic Disease Detection and DNA Amplification Using Cloned Thermostable Ligase,” Proc. Natl. Acad. Sci. USA, 88:189-193 (1991 ).
  • the ligase detection reaction can use 2 sets of complementary oligonucleotides. This is known as the ligase chain reaction which is described in the 3 immediately preceding references.
  • the ligase detection reaction can involve a single cycle which is known as the oligonucleotide ligation assay. See Landegren, et al., "A Ligase-Mediated Gene Detection Technique," Science 241: 1077-80 (1988 ); Landegren, et al., “DNA Diagnostics - Molecular Techniques and Automation,” Science 242:229-37 (1988 ); and U.S. Patent No. 4,988,617 to Landegren, et al .
  • the denaturation treatment is carried out at a temperature of 80-105°C, while hybridization takes place at 50-85°C.
  • Each cycle comprises a denaturation treatment and a thermal hybridization treatment which in total is from about one to five minutes long.
  • the ligation detection reaction involves repeatedly denaturing and hybridizing for 2 to 50 cycles.
  • the total time for the ligase detection reaction phase is 1 to 250 minutes.
  • the oligonucleotide probe sets or primers can be in the form of ribonucleotides, deoxynucleotides, modified ribonucleotides, modified deoxyribonucleotides, modified phosphate-sugar-backbone oligonucleotides, nucleotide analogs, and mixtures thereof.
  • the oligonucleotides of the oligonucleotide probe sets each have a hybridization or melting temperature (i.e. T m ) of 66-70°C. These oligonucleotides are 20-28 nucleotides long.
  • the oligonucleotide probe sets or primers have a reporter label suitable for detection.
  • useful labels include chromophores, fluorescent moieties, enzymes, antigens, heavy metals, magnetic probes, dyes, phosphorescent groups, radioactive materials, chemiluminescent moieties, and electrochemical detecting moieties.
  • a particularly important aspect of the present invention is its capability to quantify the amount of target nucleotide sequence in a sample. This can be achieved in a number of ways by establishing standards which can be internal (i.e. where the standard establishing material is amplified and detected with the sample) or external (i.e. where the standard establishing material is not amplified, and is detected with the sample).
  • infectious diseases can be detected by the process of the present invention. Typically, these are caused by bacterial, viral, parasite, and fungal infectious agents. The resistance of various infectious agents to drugs can also be determined using the present invention.
  • Bacterial infectious agents which can be detected by the present invention include Escherichia coli, Salmonella, Shigella, Klebsiella, Pseudomonas, Listeria monocytogenes, Mycobacterium tuberculosis, Mycobacterium avium-introcellulare, Yersinia, Francisella, Pasteurella, Brucella, Clostridia, Bordetella pertussis, Bacteroides, Staphylococcus aureus, Streptococcus pneumonia, B-Hemolytic strep., Corynebacteria, Legionella, Mycoplasma, Ureaplasma, Chlamydia, Neisseria gonerrhea, Neisseria meningitides, Hemophilus influenza, Enterococcus faecalis, Proteus vulgaris, Proteus mirabilis, Helicobacter pylori, Treponema palladium, Borrelia burgdorferi, Borreli
  • Fungal infectious agents which can be detected by the present invention include Cryptococcus neoformans, Blastomyces dermatitidis, Histoplasma capsulatum, Coccidioides immitis, Paracoccidioides brasiliensis, Candida albicans, Aspergillus fumigautus, Phycomyceres (Rhizopus), Sporothrix schenckii, Chromomycosis, and Maduromycosis.
  • Viral infectious agents which can be detected by the present invention include human immunodeficiency virus, human T-cell lymphocytotrophic virus, hepatitis viruses (e.g., Hepatitis B Virus and Hepatitis C Virus), Epstein-Barr Virus, cytomegalovirus, human papillomaviruses, orthomyxo viruses, paramyxo viruses, adenoviruses, corona viruses, rhabdo viruses, polio viruses, toga viruses, bunya viruses, arena viruses, rubella viruses, and reo viruses.
  • human immunodeficiency virus e.g., human T-cell lymphocytotrophic virus
  • hepatitis viruses e.g., Hepatitis B Virus and Hepatitis C Virus
  • Epstein-Barr Virus Epstein-Barr Virus
  • cytomegalovirus human papillomaviruses
  • orthomyxo viruses paramyxo viruses
  • corona viruses coron
  • Parasitic agents which can be detected by the present invention include Plasmodium falciparum, Plasmodium malaria, Plasmodium vivax, Plasmodium ovale, Onchoverva volvulus, Leishmania, Trypanosoma spp., Schistosoma spp., Entamoeba histolytica, Cryptosporidum, Giardia spp., Trichimonas spp., Balatidium coli, Wuchereria bancrofti, Toxoplasma spp., Enrerobius vermicularis, Ascaris lumbricoides, Trichuris trichiura, Dracunculus medinesis, trematodes, Diphyllobothrium latum, Taenia spp., Pneumocystis carinii, and Necator americanis.
  • the present invention is also useful for detection of drug resistance by infectious agents.
  • vancomycin-resistant Enterococcus faecium methicillin-resistant Staphylococcus aureus, penicillin-resistant Streptococcus pneumoniae, multi-drug resistant Mycobacterium tuberculosis, and AZT-resistant human immunodeficiency virus can all be identified with the present invention.
  • Genetic diseases can also be detected by the process of the present invention. This can be carried out by prenatal or post-natal screening for chromosomal and genetic aberrations or for genetic diseases.
  • detectable genetic diseases include: 21 hydroxylase deficiency, cystic fibrosis, Fragile X Syndrome, Turner Syndrome, Duchenne Muscular Dystrophy, Down Syndrome or other trisomies, heart disease, single gene diseases, HLA typing, phenylketonuria, sickle cell anemia, Tay-Sachs Disease, thalassemia, Klinefelter Syndrome, Huntington Disease, autoimmune diseases, lipidosis, obesity defects, henlophilia, inborn errors of metabolism, and diabetes.
  • Cancers which can be detected by the process of the present invention generally involve oncogenes, tumor suppressor genes, or genes involved in DNA amplification, replication, recombination, or repair.
  • oncogenes include: BRCAI gene, p53 gene, APC gene, Her2/Neu amplification, Bcr/Ab1, K-ras gene, and human papillomavirus Types 16 and 18.
  • Various aspects of the present invention can be used to identify amplifications, large deletions as well as point mutations and small deletions/insertions of the above genes in the following common human cancers: leukemia, colon cancer, breast cancer, lung cancer, prostate cancer, brain tumors, central nervous system tumors, bladder tumors, melanomas, liver cancer, osteosarcoma and other bone cancers, testicular and ovarian carcinomas, head and neck tumors, and cervical neoplasms.
  • the present invention can be used for detection, identification, and monitoring of pathogenic and indigenous microorganisms in natural and engineered ecosystems and microcosms such as in municipal waste water purification systems and water reservoirs or in polluted areas undergoing bioremediation. It is also possible to detect plasmids containing genes that can metabolize xenobiotics, to monitor specific target microorganisms in population dynamic studies, or either to detect, identify, or monitor genetically modified microorganisms in the environment and in industrial plants.
  • the present invention can also be used in a variety of forensic areas, including for human identification for military personnel and criminal investigation, paternity testing and family relation analysis, HLA compatibility typing, and screening blood, sperm, or transplantation organs for contamination.
  • the present invention has a wide variety of applications. For example, it can be used for identification and characterization of production organisms such as yeast for production of beer, wine, cheese, yogurt, bread, etc. Another area of use is with regard to quality control and certification of products and processes (e.g., livestock, pasteurization, and meat processing) for contaminants. Other uses include the characterization of plants, bulbs, and seeds for breeding purposes, identification of the presence of plant-specific pathogens, and detection and identification of veterinary infections.
  • production organisms such as yeast for production of beer, wine, cheese, yogurt, bread, etc.
  • Another area of use is with regard to quality control and certification of products and processes (e.g., livestock, pasteurization, and meat processing) for contaminants.
  • Other uses include the characterization of plants, bulbs, and seeds for breeding purposes, identification of the presence of plant-specific pathogens, and detection and identification of veterinary infections.
  • detection and quantification can be carried out using capillary or gel electrophoresis or on a solid support with an array capture oligonucleotides.
  • the mixture is contacted with the solid support at a temperature of 45-90°C and for a time period of up to 60 minutes.
  • Hybridizations may be accelerated by adding cations, volume exclusion or chaotropic agents.
  • the array is washed sequentially with a low stringency wash buffer and then a high stringency wash buffer.
  • oligonucleotide sets and the capture oligonucleotides be configured so that the oligonucleotides sets hybridize to the target nucleotide sequences at a termperature less than that which the capture oligonucleotides hybridize to the addressable array-specific portions. Unless the oligonucleotides are designed in this fashion, false positive signals may result due to capture of adjacent unreacted oligonucleotides from the same oligonucleotides set which are hybridized to the target.
  • the capture oligonucleotides can be in the form of ribonucleotides, deoxyribonucloetides, modified ribonucleotides, modified deoxyribonucleotides, peptide nucleotide analogues, modified peptide nucleotide analoges, modified phosphate-sugar backbone oligonucleotides, nucleotide analogues, and mixtures thereof.
  • the detection phase of the process involves scanning and identifying if PCR products have been produced and correlating the presence of such products to a presence or absence of the target nucleotide sequence in the test sample.
  • Scanning can be carried out by scanning electron microscopy, confocal microscopy, charge-coupled device, scanning tunnelling electron microscopy, infrared microscopy, atomic force microscopy, electrical conductance, and fluorescent or phosphor imaging. Correlating is carried out with a computer.
  • Genomic DNA was prepared from the blood of two normal human volunteers, one male and one female, according to standard techniques. Briefly, approximately 12 ml of blood was obtained in EDTA-containing blood collection tubes. Red blood cells were lysed by mixing the blood samples with 4 volumes of lysis buffer (10 mM Tris pH 8.0, 10 mM EDTA). After 10 min on ice with occasional agitation, the suspensions were centrifuged and the supernatants were decanted. The white blood cell pellets were resuspended in 20 ml of lysis buffer, and the above process was repeated.
  • lysis buffer (10 mM Tris pH 8.0, 10 mM EDTA).
  • Each cell pellet was then suspended in 15 ml of digestion buffer (50 mM Tris pH 8.0, 5 mM EDTA, 100 mM NaCl, 1 % SDS) and 3 mg (0.2 mg/ml) of proteinase K was added.
  • the cells were digested at 37° C for 5 hours.
  • the digests were extracted twice with equal volumes of phenol, then once with equal volumes of a 1:1 phenol:chloroform mixture and finally once with equal volumes of chloroform, each time centrifuging the mixture and removing the aqueous phase for the next extraction. After the final extraction and removing the aqueous phases, one tenth volume of 3 M sodium acetate, pH 6.5, was added.
  • oligonucleotides were synthesized on a 394A DNA Synthesizer (Applied Biosystems Division of Perkin-Elmer Corp., Foster City, CA.). Oligonucleotides labeled with 6-FAM were synthesized using the manufacturer's suggested modifications to the synthesis cycle (Applied Biosystems Inc., 1994) and were subsequently deprotected at 55° C for 4 hr. LDR oligonucleotides were purified by ethanol precipitation after overnight deprotection at 55° C. The primer-specific portions of the oligonucleotides used for PCR amplification were purified by polyacrylamide gel electrophoresis on 10% acrylamide/7M urea gels.
  • Oligonucleotides were visualized after electrophoresis by UV shadowing against a lightening screen and excised from the gel (Applied Biosystems Inc., 1992). They were then eluted overnight at 64° C in TNE (i.e. Tris-sodium EDTA) buffer (100 mM Tris/HCl pH 8.0 containing 500 mM NaCl and 5 mM EDTA) and recovered from the eluate using Sep Pak cartridges (Millipore Corp, Milford, MA.) following the manufacture's instructions.
  • TNE i.e. Tris-sodium EDTA
  • the concentrations of the LDR probes are given in Table 1.
  • the concentrations of oligonucleotides complementary to the oligonucleotide probes of the ligase detection reaction were higher.
  • ZipALg1F was 3.75 ⁇ g/ ⁇ l and ZipBLg2R was 2.01 ⁇ g/ ⁇ l or 524 pm/ ⁇ l and 281 pm/ ⁇ l, respectively, as determined by the formula above.
  • the downstream LDR oligonucleotides probes were phosphorylated with T4 polynucleotide kinase. Aliquots of the 5 downstream oligonucleotides equivalent to 200 pm (see Table 1) were combined with 10 ⁇ l of 10X kinase buffer (500 mM Tris/HCl pH 8.0, 100 mM MgCl 2 ), 10 ⁇ l of 10 mM ATP, 20 U T4 kinase, and sufficient water-ME to give a final volume of 100 ⁇ l. Phosphorylation was carried out at 37° C for 30 min followed by incubation for 10 min at 85° C to inactivate the T4 enzyme. The resulting concentration of the kinased LDR probe solution was 2 pm/ ⁇ l or 2000 fm/ ⁇ l in each probe.
  • the solutions of the LDR and PCR oligonucleotides were adjusted to convenient concentrations.
  • the kinased LDR probe solution was diluted fourfold in water to yield a concentration of 500fm/ ⁇ l.
  • a solution of the upstream LDR probes was made by combining volumes of the probes equivalent to 200 pm (see Table 1) with sufficient water to give a final volume of 400 ⁇ l. This created a solution 500 fm/ ⁇ l in each of the upstream LDR probes. Aliquots (20 ⁇ l) of the kinased and unkinased LDR probes were frozen for subsequent use.
  • Standard solutions of the PCR primers (10 pm/ ⁇ l) were prepared from their original solutions by combining 9.5 ⁇ l of ZipALg1F and 17.8 ⁇ l of ZipBLg2R with sufficient water to achieve a total volume of 500 ⁇ l. These solutions were frozen for use in the LDR/PCR process.
  • LDR oligonucleotide probes for quantification of gene amplications and deletions in the LDR/PCR process were designed to recognize exon 8 in the p53 tumor suppressor gene (on chromosome 17p), exon 3 of int-2 (on chromosome 11q), an internal exon in HER-2/neu (i.e. HER-2/neu/erbB oncogene) (on chromosome 17q), exon 3 in SOD (i.e. super oxide dismutase) (on chromosome 21q), and exon 6 in G6PD (i.e. glucose 6-phosphate dehydrogenase) (on chromosome Xq).
  • exon 8 in the p53 tumor suppressor gene on chromosome 17p
  • exon 3 of int-2 on chromosome 11q
  • an internal exon in HER-2/neu i.e. HER-2/neu/erbB oncogene
  • SOD i.e. super oxide dismutase
  • Each pair of LDR oligonucleotide probes has the following features: (i) The left oligonucleotide probe contains from 5' to 3' an 18 base sequence identical to the fluorescently labeled secondary oligonucleotide primer (black bar), an "adjustment sequence" (white bar), and a target-specific sequence of from 22 to 28 bases with a T m of 75°C (patterned bar); (ii) The right oligonucleotide probe contains from 5' to 3' a target-specific sequence of 20-25 bases with a T m of 75°C (patterned bar), a single Hae III or Hin P1I restriction site at slightly different positions within the target-specific sequence, and an "adjustment sequence” (white bars).
  • the two oligonucleotide probes are designed such that their combined length is exactly 96 bases, with 50 G+C bases and 46 A+T bases.
  • the position of each unique restriction site generates a product which differs by at least 2 bases from the other products.
  • Each oligonucleotide probe set has an exon-specific region chosen to ligate the junction sequence of (A, T)C ⁇ C(A, T). This junction sequence corresponds to either a proline residue (codon CCN) or the complementary sequence of a tryptophan residue (TGG). These sequences were chosen to minimize differences in ligation rates and the chance of a polymorphism at the ligation junction.
  • Oligonucleotides were assembled by standard phosphoramidite chemistry on an Expedite DNA synthesizer (Perseptive Biosystems, Framingham, MA). Oliogonucleotides 5'-end labelled with 6-FAM, TET, and HEX were synthesized using the appropriate dye phosphoramidites (Perkin Elmer-Applied Biosystems) and purified with Oligonucloetide Purification Cartridges (Perkin Elmer-Applied Biosystems) following the manufacturer's protocol ( Applied Biosystems Division-Perkin Elmer Corp., "Synthesis and Purification of Fluorescently Labeled Oligonucleotides Using Dye Phosphoramidites," User Bulletin, number 78, applied Biosystems Division, Foster City, CA, (1994 )),.
  • oligonucleotides were checked for purity on an Applied Biosystems 270-HT capillary electrophoresis instrument using a mPAGE-3 column (J&W Scientific, Folsom, CA). Only oligonucleotides that were greater than 95% pure were used for the experiments. Oligonucleotides were resuspended in 250 ml TE (10mM Tris/HCl and 5 mM EDTA pH 8.0). Typical concentrations were 300-500 mM for crude stock solutions and 100-200 mM for OPC (i.e. O ligonucleotide P urification C olumns available form Applied Biosystems) purified stock solutions. For PCR and LDR, oligonucleotides were diluted to working solutions of 10 mM (10 pmoles/ml) or 5mM (5 pmoles/ml).
  • the 12 LDR common oligonucleotides were phosphorylated at the 5' end to permit ligation to the fluorescent labeled oligonucleotides.
  • the oligonucleotides are shown below in Table 9.
  • Table 9 - LDR Oligonucleotide Sequences Locus Allele-Specific Oligonucleotide Common Oligonucleotide (5' ⁇ 3') (5' ⁇ 3') 1 FAM-AGCTTCAATGATGAGAACCTGC P-GCATAGTGGTGGCTGACCTGTTC ATAT TET-AGCTTCAATGATGAGAACCTGT 2 FAM-CTCCATGGCCCCAGCC P-AGCACTGGTGCCCTGTGAG TET-CTCCATGGGCCCAGCT 3 FAM-GGGGACAGCCATGCACTGA P-GCCTCTGGTAGCCTTTCAACCAT A TET-GGGGACAGCCATGCACTGC 4 FAMTTAGAAATCATCAAGCCTAGGTCAT P-CACCTTTTACCTTCCTG
  • LDR primer sets were designed in two ways: (i) allele-specific primers were of the same length but contained either FAM or TET label; or (ii) the allele-specific primers were both labeled with HEX but differed in length by two bases.
  • T4 polynucleotide kinase (Boehringer Mannheim, Indianapolis, IN).
  • a common oligomer was diluted into 50 ⁇ l of kinase buffer (50 mM Tris/HCl, 10 mM MgCl 2 , and 1 mM ATP) to a final concentration of 1 mM (500 pmol in 50 ⁇ l).
  • Ten units of T4 kinase was added, and the reaction was incubated at 37°C for 30 min. The T4 kinase was inactivated by heating at 95°C for 10 min.
  • the site numbers are specific single point variations located within the respective genes. All variations indicated are defined on the sense strand. Genbank accession numbers are indicated in parentheses. Chr., chromosome; Het, heterozygosity.
  • PCR amplifications were performed using genomic DNA isolated from whole blood using a Purgene DNA Isolation Kit (Gentra Systems, Inc., Minneapolis, MI) according to the manufacturer's instructions.
  • PCR buffer (10 mM Tris/HCl pH 8.3, 10 mM KCl, 4 mM MgCl 2 , 0.4 mM each dNTP), 10-100 ng of genomic target DNA, PCR hybrid primer pairs 1-12 (2 pmol of each primer), and 1.3 units of AmpliTaq DNA polymerase Stoffel fragment (Applied Biosystems) was placed in a thin-walled MicroAmp reaction tube (Applied Biosystems).
  • Each hybrid primer consisted of a gene-specific 3' region (16-29 bases) and a 5' region (22 bases) corresponding to one of two sets of universal (i.e.
  • the primary PCR process was carried out under the following conditions: 5.9 ⁇ l H 2 O 5 ⁇ l primer pairs 1-12 (2 pmol each primer) 2.5 ⁇ l 10X Stoffel fragment 4 ⁇ l 25 mM MgCl 2 5 ⁇ l 2 mM dNTP stock (each) 2.5 ⁇ l genomic DNA (10 ng) 0.13 ⁇ l Stoffel Frag. (1.3 units) 25 ⁇ l Total
  • the primary PCR cycling conditions were as follows:
  • the PCR products were separated on an Applied Biosystems 373 DNA sequencer.
  • a 3 ml aliquot of PCR sample was mixed with 3 ml of formamide containing fluorescently labeled Genescan-2500 [TAMRA] size standard (Applied Biosystems).
  • the formamide/standard solution was prepared by adding 50 ml Genescan-2500 size standard [TAMRA] to 450 ml of formamide.
  • the sample was heated at 95°C for 2 min, quick cooled in ice, and electrophoresed through a denaturing 8% polyacrylamide gel in an Applied Biosystems 373 DNA sequencer running Genescan version 1.2 software.
  • the sizes of the fluorescently labeled products were automatically computed by the Genescan analysis software using the local Southern method.
  • the electropherograms clearly showed 12 distinct products ( Figure 28 ).
  • the uniform amount of each product was attributed to the similar size of each amplicon and the use of the primary primers with portions complementary to the secondary primers, which annealed with identical affinities to the 12 amplicons without the need to carefully adjust reaction conditions.
  • the computed sizes of the products which ranged from 135 to 175 bp, matched exactly to their actual sizes (see Table 12).
  • PCR product amplified using unlabeled PCR universal primers served as the target for the LDR.
  • the polymerase in the PCR was inactivated by either freeze-thawing or adding EDTA/proteinase K to a final concentration of 5 mM and 100 mg/ml, respectively, and heating to 37°C for 30 min and 95°C for 10 min.
  • Proteinase K digestion was carried out under the following conditions: 20 ⁇ l PCR product + 2.5 ⁇ l 500 mg/ml proteinase K 25 ⁇ l Total 60°C for 60 min. 95°C for 10 min to heat kill proteinase K.
  • PCR product Four microliters of PCR product was diluted in 20 ⁇ l of LDR mix containing 50 mM Tris/HCl pH 8.5, 50 mM KCl, 10 mM MgCl 2 1 mM NAD+, 10 mM DTT, LDR oligonucleotide sets 1-12 (200 fmol of each oligonucleotide), and 10 units of Thermus aquaticus DNA ligase ( Barany, F. and Gelfand, D., "Cloning, Overexpression, and Nucleotide Sequence of a Thermostable DNA Ligase-Encoding Gene," Gene, 109:1-11 (1991 ).
  • Each LDR oligonucleotide probe set consisted of two allele-specific oligonucleotides and a common oligonucleotide.
  • Each pair of discriminating allele-specific oligonucleotide probes in the LDR oligonucleotide probe sets 1,2,3,4,6,7,8 and 9 were the same size, with one oligonucleotide labeled with 6-FAM and the other labeled with TET.
  • each pair of allele-specific oligonucleotides differed by 2 bases (the larger oligonucleotide had a 5' tail that was not complementary to the target sequence), and both oligonucleotides were labeled with HEX.
  • Thermal cycling was performed for 1 cycle of 95°C for 2 min to denature, then 20 cycles of 95°C for 30 sec to denature, and 65°C for 4 min to ligate.
  • the LDR process was carried out as follows: 4 ⁇ l PCR product 2 ⁇ l LDR oligo sets 1-12 (200 fmol each oligo) 2 ⁇ l 10X T.
  • Stock of Ligase 0.5 ⁇ l of 625 u/ml + 3.2 ⁇ l 10X buffer + 27.5 ⁇ l H 2 O
  • the first individual ( Figure 29A-D ; Table 13, individual 1) was heterozygous at polymorphic sites 1-7, and 10-12.
  • Heterozygosity at sites 1-4 and 6-7 was indicated by the detection of both 6-FAM and TET labeled products ( Figure 29 , panels B and C) at the respective positions on the electropherograms.
  • Heterozygosity at sites 5 and 11-12 was indicated by the presence of two HEX labeled products, differing in size by 2 bases, for each of these loci ( Figure 29 , panel D).
  • the one product detected at sites 8 and 9 ( Figure 29 , panels B and C) established that each of these loci was homozygous.
  • the second individual ( Figure 29E-F and G-H ; Table 13, individual 2) was heterozygous only at sites 3,5,6 and 9 and homozygous at sites 1, 2, 4, 7, 8, 10-12. There was a total of 8 differences in the genotypes at these positions between the two persons. Three additional individuals were typed, and all 5 persons had distinct genotypes based on the 12 loci (Table 13).

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Cell Biology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Description

  • This invention was developed with government funding under National Institutes of Health Grant No. GM41337-06. The U.S. Government may retain certain rights.
  • FIELD OF THE INVENTION
  • The present invention relates to the detection of nucleic acid sequence differences using coupled polymerase chain reaction ("PCR"). The present invention involves a primary polymerase chain reaction coupled to a secondary polymerase chain reaction, as set out in the claims.
  • BACKGROUND OF THE INVENTION Multiplex Detection
  • Large-scale multiplex analysis of highly polymorphic loci is needed for practical identification of individuals, e.g., for paternity testing and in forensic science (Reynolds et al., Anal. Chem., 63:2-15 (1991)), for organ-transplant donor-recipient matching (Buyse et al., Tissue Antigens, 41:1-14 (1993) and Gyllensten et al., PCR Meth. Appl, 1:91-98 (1991)), for genetic disease diagnosis, prognosis, and pre-natal counseling (Chamberlain et al., Nucleic Acids Res., 16:11141-11156 (1988) and L. C. Tsui, Human Mutat., 1:197-203 (1992)), and the study of oncogenic mutations (Hollstein et al., Science, 253:49-53 (1991)). In addition, the cost-effectiveness of infectious disease diagnosis by nucleic acid analysis varies directly with the multiplex scale in panel testing. Many of these applications depend on the discrimination of single-base differences at a multiplicity of sometimes closely spaced loci.
  • A variety of DNA hybridization techniques are available for detecting the presence of one or more selected polynucleotide sequences in a sample containing a large number of sequence regions. In a simple method, which relies on fragment capture and labeling, a fragment containing a selected sequence is captured by hybridization to an immobilized probe. The captured fragment can be labeled by hybridization to a second probe which contains a detectable reporter moiety.
  • Another widely used method is Southern blotting. In this method, a mixture of DNA fragments in a sample is fractionated by gel electrophoresis, then fixed on a nitrocellulose filter. By reacting the filter with one or more labeled probes under hybridization conditions, the presence of bands containing the probe sequences can be identified. The method is especially useful for identifying fragments in a restriction-enzyme DNA digest which contains a given probe sequence and for analyzing restriction-fragment length polymorphisms ("RFLPs").
  • Another approach to detecting the presence of a given sequence or sequences in a polynucleotide sample involves selective amplification of the sequence(s) by polymerase chain reaction. U.S. Patent No. 4,683,202 to Mullis, et al. and R.K. Saiki, et al., Science 230:1350 (1985). In this method, primers complementary to opposite end portions of the selected sequence(s) are used to promote, in conjunction with thermal cycling, successive rounds of primer-initiated replication. The amplified sequence(s) may be readily identified by a variety of techniques. This approach is particularly useful for detecting the presence of low-copy sequences in a polynucleotide-containing sample, e.g., for detecting pathogen sequences in a body-fluid sample.
  • More recently, methods of identifying known target sequences by probe ligation methods have been reported. U.S. Patent No. 4,883,750 to N.M. Whiteley, et al. , D.Y. Wu, et al., Genomics 4:560 (1989), U. Landegren, et al., Science 241:1077 (1988), and E. Winn-Deen, et al., Clin. Chem. 37:1522 (1991). In one approach, known as oligonucleotide ligation assay ("OLA"), two probes or probe elements which span a target region of interest are hybridized to the target region. Where the probe elements basepair with adjacent target bases, the confronting ends of the probe elements can be joined by ligation, e.g., by treatment with ligase. The ligated probe element is then assayed, evidencing the presence of the target sequence.
  • In a modification of this approach, the ligated probe elements act as a template for a pair of complementary probe elements. With continued cycles of denaturation, hybridization, and ligation in the presence of pairs of probe elements, the target sequence is amplified linearly, allowing very small amounts of target sequence to be detected and/or amplified. This approach is referred to as ligase detection reaction. When two complementary pairs of probe elements are utilized, the process is referred to as the ligase chain reaction which achieves exponential amplification of target sequences. F. Barany, "Genetic Disease Detection and DNA Amplification Using Cloned Thermostable Ligase," Proc. Nat'l Acad. Sci. USA, 88:189-93 (1991) and F. Barany, "The Ligase Chain Reaction (LCR) in a PCR World," PCR Methods and Applications, 1:5-16 (1991).
  • Another scheme for multiplex detection of nucleic acid sequence differences is disclosed in U.S. Patent No. 5,470,705 to Grossman et. al. where sequence-specific probes, having a detectable label and a distinctive ratio of charge/translational frictional drag, can be hybridized to a target and ligated together. This technique was used in Grossman, et. al., "High-density Multiplex Detection of Nucleic Acid Sequences: Oligonucleotide Ligation Assay and Sequence-coded Separation," Nucl. Acids Res, 22(21):4527-34 (1994) for the large scale multiplex analysis of the cystic fibrosis transmembrane regulator gene.
  • Jou, et. al., "Deletion Detection in Dystrophia Gene by Multiplex Gap Ligase Chain Reaction and Immunochromatographic Strip Technology," Human Mutation 5:86-93 (1995) relates to the use of a so called "gap ligase chain reaction" process to amplify simultaneously selected regions of multiple exons with the amplified products being read on an immunochromatographic strip having antibodies specific to the different haptens on the probes for each exon.
  • There is a growing need (e.g., in the field of genetic screening) for methods useful in detecting the presence or absence of each of a large number of sequences in a target polynucleotide. For example, as many as 400 different mutations have been associated with cystic fibrosis. In screening for genetic predisposition to this disease, it is optimal to test all of the possible different gene sequence mutations in the subject's genomic DNA, in order to make a positive identification of "cystic fibrosis". It would be ideal to test for the presence or absence of all of the possible mutation sites in a single assay. However, the prior-art methods described above are not readily adaptable for use in detecting multiple selected sequences in a convenient, automated single-assay format.
  • Solid-phase hybridization assays require multiple liquid-handling steps, and some incubation and wash temperatures must be carefully controlled to keep the stringency needed for single-nucleotide mismatch discrimination. Multiplexing of this approach has proven difficult as optimal hybridization conditions vary greatly among probe sequences.
  • Developing a multiplex PCR process that yields equivalent amounts of each PCR product can be difficult and laborious. This is due to variations in the annealing rates of the primers in the reaction as well as varying polymerase extension rates for each sequence at a given Mg2+ concentration. Typically, primer, Mg2+, and salt concentrations, along with annealing temperatures are adjusted in an effort to balance primer annealing rates and polymerase extension rates in the reaction. Unfortunately, as each new primer set is added to the reaction, the number of potential amplicons and primer dimers which could form increase exponentially. Thus, with each added primer set, it becomes increasingly more difficult and time consuming to work out conditions that yield relatively equal amounts of each of the correct products.
  • Allele-specific PCR products generally have the same size, and an assay result is scored by the presence or absence of the product band(s) in the gel lane associated with each reaction tube. Gibbs et al., Nucleic Acids Res., 17:2437-2448 (1989). This approach requires splitting the test sample among multiple reaction tubes with different primer combinations, multiplying assay cost. PCR has also discriminated alleles by attaching different fluorescent dyes to competing allelic primers in a single reaction tube (F.F. Chehab, et al., Proc. Natl. Acad. Sci. USA, 86:9178-9182 (1989)), but this route to multiplex analysis is limited in scale by the relatively few dyes which can be spectrally resolved in an economical manner with existing instrumentation and dye chemistry. The incorporation of bases modified with bulky side chains can be used to differentiate allelic PCR products by their electrophoretic mobility, but this method is limited by the successful incorporation of these modified bases by polymerase, and by the ability of electrophoresis to resolve relatively large PCR products which differ in size by only one of these groups. Livak et al., Nucleic Acids Res., 20:4831-4837 (1989). Each PCR product is used to look for only a single mutation, making multiplexing difficult.
  • Ligation of allele-specific probes generally has used solid-phase capture (U. Landegren et al., Science, 241:1077-1080 (1988); Nickerson et al., Proc. Natl. Acad. Sci. USA, 87:8923-8927 (1990)) or size-dependent separation (D.Y. Wu, et al., Genomics, 4:560-569 (1989) and F. Barany, Proc. Natl. Acad. Sci., 88:189-193 (1991)) to resolve the allelic signals, the latter method being limited in multiplex scale by the narrow size range of ligation probes. Further, in a multiplex format, the ligase detection reaction alone cannot make enough product to detect and quantify small amounts of target sequences. The gap ligase chain reaction process requires an additional step - polymerase extension. The use of probes with distinctive ratios of charge/translational frictional drag for a more complex multiplex will either require longer electrophoresis times or the use of an alternate form of detection.
  • The need thus remains for a rapid single assay format to detect the presence or absence of multiple selected sequences in a polynucleotide sample.
  • Microsatellite Analysis
  • Tandem repeat DNA sequences known as microsatellites represent a very common and highly polymorphic class of genetic elements within the human genome. These microsatellite markers containing small repeat sequences have been used for primary gene mapping and linkage analysis. Weber, J.L. et al., Am. J. Hum. Genet. 44: 388-396 (1989); Weissenbach, J. et al., Nature (London) 359: 794-800 (1992). PCR amplification of these repeats allows rapid assessment for loss of heterozygosity and can greatly simplify procedures for mapping tumor suppressor genes. Ruppert, J.M., et al., Cancer Res. 53: 5093-94 (1993); van der Riet, et al., Cancer Res. 54: 1156-58 (1994); Nawroz, H., et al., Cancer Res. 54: 1152-55 (1994); Cairns, P., et al., Cancer Res. 54: 1422-24 (1994). More recently, they have been used to identify specific mutations in certain inherited disorders including Huntington disease, fragile X syndrome, myotonic dystrophy, spinocerebellar ataxia type I, spinobulbar muscular atrophy, and hereditary dentatorubral-pallidoluysian atrophy. The Huntington's Disease Collaborative Research Group Cell 72: 971-83 (1993); Kremer, E.J., et al., Science 252: 1711-14 (1991); Imbert, G., et al., Nat. Genet. 4: 72-76 (1993); Orr, H.T., et al., Nat. Genet. 4: 221-226 (1993); Biancalana, V., et al., Hum. Mol. Genet. 1: 255-258 (1992); Chung, M.-Y., et al., Nat. Genet. 5: 254-258 (1993); Koide, R., et al., Nat. Genet. 6: 9-13 (1994). These inherited disorders appear to arise from the expansion of trinucleotide repeat units within susceptible genes. A more widespread microsatellite instability, demonstrated by expansion or deletion of repeat elements in neoplastic tissues, was first reported in colorectal tumors. Peinado, M.A., et al. Proc. Natl. Acad. Sci. USA 89: 10065-69 (1992); Ionov, Y., Nature (London) 363: 558-61 (1993); Thibodeau, S.N., et al., Science 260: 816-819 (1993) and later in several other tumor types (Risinger, J.I., Cancer Res. 53: 5100-03 (1993); Han, H.-J., et al., Cancer Res. 53: 5087-89 (1993); Peltomäki, P., Cancer Res. 53: 5853-55 (1993); Gonzalez-Zulueta, M., et al., Cancer Res. 53: 5620-23 (1993); Merlo, A., et al., Cancer Res. 54: 2098-2101 (1994)). In hereditary nonpolyposis colorectal carcinoma patients, this genetic instability is apparently due to inherited and somatic mutations in mismatch repair genes. Leach, F., et al., Cell 75: 1215-1225 (1993); Fishel, R., et al., Cell 75: 1027-38 (1993); Papadopoulos, N., et al., Science 263: 1625-29 (1994); Bronner, C.E., et al., Nature (London) 368: 258-61 (1994).
  • PCR is commonly used for microsatellite analysis in identifying both the appearance of new polymorphisms and the loss of heterozygosity in cancer detection. L. Mao, et. al., "Microsatellite Alterations as Clonal Markers for the Detection of Human Cancer," Proc. Nat'l Acad. Sci USA 91(21): 9871-75 (1994); L. Mao, et. al., "Molecular Detection of Primary Bladder Cancer by Microsatellite Analysis," Science 271:659-62 (1996); D. Radford, et. al., "Allelotyping of Ductal Carcinoma in situ of the Breast: Detection of Loci on 8p, 13q, 161, 17p and 17q," Cancer Res. 55(15): 3399-05 (1995). In using PCR for such purposes, each PCR reaction is run individually and separated on a sequencing gel.
  • Although these references demonstrate that PCR has application to diagnosis and prognosis of certain cancers, this type of analysis is deficient, because it does not permit a high throughput and requires size separation. In addition, there are problems with PCR slippage, causing researchers to shift to tri-, tetra-, and higher nucleotide repeat units, making cancer detection more difficult.
  • Microsatellite markers have also been used for colon cancer detection (L. Cawkwell, et. al., "Frequency of Allele Loss of DCC, p53, RB1, WTl, NF1, NM23, and APC/MCC in Colorectal Cancer Assayed by Fluorescent Multiplex Polymerase Chain Reaction," Br. J. Cancer 70(5): 813-18 (1994)) and for genome mapping (P. Reed, et. al., "Chromosome-specific Microsatellite Sets for Fluorescent-Based, Semi-Automated Genome Mapping," Nat. Genet. 7(3): 390-95 (1994)). However, the key to such multiplex processes is the ability to perform them in a single reaction tube. Conventional multiplex microsatellite marker approaches require careful attention to primer concentrations and amplification conditions. Although PCR products can be pooled in sets, this requires a prerun on agarose gels to insure that the mixture has about equal amounts of DNA in each band.
  • Human Identification
  • PCR has also been used for human identification, such as paternity testing, criminal investigations, and military personnel identification. A. Syvanen et. al., "Identification of Individuals by Analysis of Biallelic DNA Markers, Using PCR and Solid-Phase Mini-Sequencing" Am. J. Hum. Genet. 52(1): 46-59 (1993) describes a mini-sequencing approach to human identification. The technique requires PCR amplification of individual markers with at most 4 PCR reactions being carried out at a time in a single PCR tube. Mini-sequencing is carried out to determine individual polymorphisms.
  • Coupled Processes
  • G. Deng, et. al., "An Improved Method of Competitive PCR for Quantitation of Gene Copy Number," Nucl, Acids Res. 21: 4848-49 (1993) describes a competitive PCR process. Here, two PCR steps are utilized with different sets of primers being used for each gene and its equivalent standard.
  • T. Msuih, et al., "Novel, Ligation-Dependent PCR Assay for Detection of Hepatitis C. Virus in Serum, "J. Clin Microbio. 34: 501-07 (1996) and Y. Park, et al., "Detection of HCV RNA Using Ligation-Dependent Polymerase Chain Reaction in Formalin-Fixed Paraffin-Embedded Liver Tissue" (submitted) describe the use of a LDR/PCR process in work with RNA.
  • US Patent No. 5,512,441 discloses a quantitative method for early detection of mutant alleles and diagnostic kits for carrying out the method.
  • WO 96/15271 describes a multiplex ligations-dependent amplification process.
  • Lin et al (1996) PNAS 93, p2582-2587 describes a PCR-based multiplex approach for multiplex genotype determination at a large number of gene loci.
  • Belgrader et al (1996) Genome Science & Technology 1(2), 7-87 describes a multiplex PCR-Ligase detection reaction assay for human identity testing.
  • SUMMARY OF THE INVENTION
  • The present invention is directed to the detection of nucleic acid sequence differences using coupled PCR processes. The present invention can be carried out using primary PCR coupled to secondary PCR as set out in the claims. This requires the use of coupled reactions for multiplex detection of nucleic acid sequence differences where oligonucleotides from an early phase of each process contain sequences which may be used by oligonucleotides from a later phase of the process.
  • Primary PCR/Secondary PCR Process
  • The present invention involves a method for identifying two or more of a plurality of sequences differing by one or more insertions or deletions, in a plurality of target nucleotide sequences as set out in the claims. This method involves subjecting a sample potentially containing one or more target nucleotide sequences with a plurality of sequence differences to two successive polymerase chain reaction phases.
  • For the first polymerase chain reaction phase, one or more primary oligonucleotide primer groups are provided where each group comprises two or more primary oligonucleotide primer sets. Each set has a first oligonucleotide primer, having a target-specific portion and a 5' upstream secondary primary-specific portion, and a second oligonucleotide primer, having a target-specific portion and a 5' upstream secondary primer-specific portion. The first oligonucleotide primers of each set in the same group contain the same 5' upstream secondary primer-specific portion and the second oligonucleotide primers of each set in the same group contain the same 5' upstream secondary primer-specific portion. The oligonucleotide primers in a particular set are suitable for hybridization on complementary strands of a corresponding target nucleotide sequence to permit formation of a polymerase chain reaction product. However, there is a mismatch which interferes with formation of such a polymerase chain reaction product when the primary oligonucleotide primers hybridize to any other nucleotide sequence present in the sample. As set out in the claims, the polymerase chain reaction products in a particular set may be distinguished from other polymerase chain reaction products with the same group or other groups. The primary oligonucleotide primers are blended with the sample and the polymerase to form a primary polymerase chain reaction mixture.
  • The primary polymerase chain reaction mixture is subjected to two or more polymerase chain reaction cycles involving a denaturation treatment, a hybridization treatment, and an extension treatment, as described above. During the hybridization treatment, the target-specific portion of a primary oligonucleotide primer is hybridized to the target nucleotide sequences. In the extension treatment, the hybridized primary oligonucleotide primers are extended to form primary extension products complementary to the target nucleotide sequence to which the primary oligonucleotide primer is hybridized, as set out in the claims.
  • Although the upstream secondary primer-specific portions of a primary oligonucleotide primer set are not present on the target DNA, their sequences are copied by the second and subsequent cycles of the primary polymerase chain reaction phase. As a result, the primary extension products produced after the second and subsequent cycles have the secondary primer-specific portions of their 5' ends and the complement of primer-specific portion on the 3' ends.
  • In the second polymerase chain reaction phase of this aspect of the present invention, one or a plurality of secondary oligonucleotide primer sets are provided. Each set has a first secondary primer having a detectable reporter label and containing the same sequence as the 5' upstream portion of a first primary oligonucleotide primer, and a second secondary primer containing the same sequence as the 5' upstream primer of the second primary oligonucleotide primer from the same primary oligonucleotide primer set as the first primary oligonucleotide sequence contained by the first secondary primer. A set of secondary oligonucleotide primers amplify the primary extension products in a given group. The secondary oligonucleotide primers are blended with the primary extension products and the polymerase to form a secondary polymerase chain reaction mixture.
  • The secondary polymerase chain reaction mixture is subjected to one or more polymerase chain reaction cycles involving a denaturation treatment, a hybridization treatment, and an extension treatment, as described above. In the hybridization treatment, the secondary oligonucleotide primers are hybridized to the primary extension products, while the extension treatment causes the hybridized secondary oligonucleotide primers to be extended to form secondary extension products complementary to the primary extension products as set out in the claims. After subjecting the secondary polymerase chain reaction mixture to the two or more polymerase chain reaction cycles, the labelled secondary extension products are detected as set out in the claims. This indicates the presence of one or more target nucleotide sequences in the sample.
  • The primary PCR/secondary PCR process of the present invention provides significant advantages over Southern hybridization, competitive PCR, and microsatellite marker analysis in detecting nucleotide deletions which cause a loss of heterozygosity. Although Southern hybridization is more accurate than competitive PCR, it is quite labor intensive, requires large amounts of DNA, and neither technique can be multiplexed. Current multiplex microsatellite marker approaches require careful attention to primer concentrations and amplification conditions.
  • The primary PCR/secondary PCR process of the present invention overcomes these difficulties encountered in the prior art. In the primary PCR phase, the primary oligonucleotide primers flank dinucleotide or other repeat sequences and include a secondary primer-specific portion. The primary PCR phase is carried out at low concentrations of these primers to allow several loci to undergo amplification at the same time. The secondary PCR phase causes amplification to continue at the same rate with target-specific secondary primers being selected to space one set of microsatellite markers from the adjacent set. The primary PCR/secondary PCR process can be used to carry out multiplex detection in a single PCR tube and with single gel lane analysis.
  • The present invention is useful in carrying out a microsatellite marker analysis to identify nucleotide deletions in a gene. Such multiplex detection can be carried out in a single reaction tube. However, the primary PCR/secondary PCR process cannot distinguish amplifications from deletions, so, when making such distinctions, this process must be used in conjunction with the described LDR/PCR process or a differential PCR process.
  • BRIEF DESCRIPTION OF THE DRAWINGS
    • Figure 1 is a flow diagram depicting a primary PCR/secondary PCR/LDR process for detection of germline mutations, such as point mutations, by electrophoresis or capture on an addressable array. Note that the term "zip-code" which appears in Figure 1 and other drawings refers to a sequence specific to a subsequently used primer or probe but not to either the target sequence or other genome sequences.
    • Figure 2 is a flow diagram depicting a primary PCR/secondary PCR/LDR process for detection of biallelic polymorphisms by electrophoresis or capture on an addressable array.
    • Figure 3 is a flow diagram depicting a primary PCR/secondary PCR/LDR process for detection of cancer-associated mutations by electrophoresis or capture on an addressable array.
    • Figure 4 is a schematic diagram depicting a primary PCR/secondary PCR/LDR process for detection of biallelic polymorphisms.
    • Figure 5 is a schematic diagram depicting a primary PCR/secondary PCR/LDR process for detection of allelic differences using LDR oligonucleotide probes which distinguish all possible bases at a given site.
    • Figure 6 is a schematic diagram depicting a primary PCR/secondary PCR/LDR process for detection of the presence of any possible base at two nearby sites using LDR oligonucleotide probes which distinguish all possible bases at a given site.
    • Figure 7 is a schematic diagram depicting a primary PCR/secondary PCR/LDR process for detection of cancer-associated mutations at adjacent alleles.
    • Figure 22 is a flow diagram depicting a primary PCR/secondary PCR process for detection of microsatellite repeats.
    • Figure 23 is a schematic diagram depicting a primary PCR/secondary PCR process for multiplex detection of insertions and deletions in microsatellite repeats.
    • Figures 28A-C show electropherogram results for the PCR phase of a primary PCR/secondary PCR/LDR process. Multiplex PCR amplification of 12 loci using primary PCR oligonucleotide primers produces approximately equal amounts of product. Over 80 gene regions with single-base polymorphisms were identified from the Human Genome Database. Twelve of these (see Table 10 and Figures 29A-H) were amplified in a primary PCR phase as follows: Long primary PCR oligonucleotide primers were designed to have gene-specific 3' ends and 5' ends complementary to one of two sets of secondary PCR oligonucleotide primers. The upstream primary PCR oligonucleotide primers were synthesized with either FAM (i.e. 6-carboxyfluorescein; fluorescent dye used in sequencing and mutation detection) or TET (i.e. tetrachlorinated-6-carboxyfluorescein; fluorescent dye used in sequencing/mutation detection) fluorescent labels. All 24 base long primary PCR oligonucleotide primers were used at low concentration (2 picomole of each primer in 20 µl) in a 15 cycle primary PCR phase. After this, the two sets of secondary PCR oligonucleotide primers were added at higher concentrations (25 picomoles of each) and the secondary PCR phase was conducted for an additional 25 cycles. The products were separated on a 373 DNA Sequencer (Applied Biosystems). Panel A shows the electropherogram results for the FAM- and TET-labelled products combined. Panel B shows the FAM-labelled products alone. Panel C shows the TET-labelled products alone. The process produces similar amounts of multiplexed products without the need to adjust carefully primer concentrations or PCR conditions.
    • Figures 29A-H show electropherogram results for the LDR phase of a primary PCR/secondary PCR/LDR process in detecting 12 biallelic genes for forensic identification. The primary and secondary PCR phases for the 12 polymorphic genes were performed as described in Fig. 28A-C. However, the secondary PCR oligonucleotide primers were not fluorescently labelled. The secondary PCR process extension products were diluted into a ligase buffer containing 36 LDR oligonucleotide probes (one common and two discriminating primers for each locus). LDR oligonucleotide probe sets were designed in two ways: (i) allele-specific oligonucleotide probes were of the same length but contained either the FAM or TET label; or (ii) the allele-specific oligonucleotide probes were both labelled with HEX (i.e. hexachlorinated-6-carboxyfluorescein; fluorescent dye used in sequencing and mutation detection) but differed in length by two basepairs. After 20 cycles of the LDR phase, the ligation product sequences were resolved using a 10% polyacrylamide sequencing gel on a 373 DNA Sequencer (Applied Biosystems). Panel A and E show the 12 loci PCR/LDR profiles of two individuals. Panels B, C, and D show, respectively, the FAM, TET, and HEX data for the individual in panel A. Panels F, G, and H show, respectively, the FAM, TET, and HEX data for the individual in panel E. The individual in panel A is homozygous only at locus 6 (ALDOB (i.e. aldolase B)) and locus 8 (IGF (i.e. insulin growth factor)). The individual in panel E is heterozygous only at loci 3 (C6 (i.e. complement component C6)), 5 (NF1 (i.e. neurofibromatosis)), 6 (ALDOB), and 8 (IGF). This demonstrates that the primary PCR/primary PCR/LDR process can simultaneously distinguish both homozygous and heterozygous genotypes at multiple positions.
    Primary PCR/Secondary PCR Process
  • The invention involves a method for identifying two or more of a plurality of sequences differing by one or more, insertions or, deletions in a plurality of target nucleotide sequences as set out in the claims. This method involves subjecting a sample potentially containing one or more target nucleotide sequences with a plurality of sequence differences to two successive polymerase chain reaction phases.
  • For the first polymerase chain reaction phase, one or more primary oligonucleotide primer groups are provided where each group comprises more than one primary oligonucleotide primer sets. Each set has a first oligonucleotide primer, having a target-specific portion and a 5' upstream secondary primary-specific portion, and a second oligonucleotide primer, having a target-specific portion and a 5' upstream secondary primer-specific portion. The first oligonucloetide primers of each set in the same group contain the same 5' upstream secondary primer-specific portion and the second oligonucleotide primers of each set in the same group contain the same 5' upstream secondary primer-specific portion. The oligonucleotide primers in a particular set are suitable for hybridization on complementary strands of a corresponding target nucleotide sequence to permit formation of a polymerase chain reaction product. However, there is a mismatch which interferes with formation of such a polymerase chain reaction product when the primary oligonucleotide primers hybridize to any other nucleotide sequence present in the sample. As set out in the claims, the polymerase chain reaction products in a particular set may be distinguished from other polymerase chain reaction products with the same group or other groups. The primary oligonucleotide primers are blended with the sample and the polymerase to form a primary polymerase chain reaction mixture.
  • The primary polymerase chain reaction mixture is subjected to two or more polymerase chain reaction cycles involving a denaturation treatment, a hybridization treatment, and an extension treatment, as described above. During the hybridization treatment, the target-specific portion of a primary oligonucleotide primer is hybridized to the target nucleotide sequences. In the extension treatment, the hybridized primary oligonucleotide primers are extended to form primary extension products complementary to the target nucleotide sequence to which the primary oligonucleotide primer is hybridized.
  • Although the upstream secondary primer-specific portions of a primary oligonucleotide primer set are not present on the target DNA, their sequences are copied by the second and subsequent cycles of the primary polymerase chain reaction phase. As a result, the primary extension products produced after the second cycle have the secondary primer-specific portions on their 5' ends and the complement of primer-specific portion on their 3' ends.
  • In the second polymerase chain reaction phase of this aspect of the present invention, one or a plurality of secondary oligonucleotide primer sets are provided. Each set has a first secondary primer having a detectable reporter label and containing the same sequence as the 5' upstream portion of a first primary oligonucleotide primer, and a second secondary primer containing the same sequence as the 5' upstream primer of the second primary oligonucleotide primer from the same primary oligonucleotide primer set as the first primary oligonucleotide sequence contained by the first secondary primer. A set of secondary oligonucleotide primers amplify the primary extension products in a given group.
    The secondary oligonucleotide primers are blended with the primary extension products and the polymerase to form a secondary polymerase chain reaction mixture.
  • The secondary polymerase chain reaction mixture is subjected to one or more polymerase chain reaction cycles involving a denaturation treatment, a hybridization treatment, and an extension treatment, as described above. In the hybridization treatment, the secondary oligonucleotide primers are hybridized to the primary extension products, while the extension treatment causes the hybridized secondary oligonucleotide primers to be extended to form secondary extension products complementary to the primary extension products. After subjecting the secondary polymerase chain reaction mixture to the two or more polymerase chain reaction cycles, the labelled secondary extension products are detected. This indicates the presence of one or more target nucleotide sequences in the sample.
  • Figure 22 is a flow diagram depicting a primary PCR/secondary PCR process, in accordance with the present invention, for detection of microsatellite repeats. In step 1 (i.e. the primary PCR phase), after DNA sample preparation, multiple exons are amplified using Taq polymerase under hot start conditions with oligonucleotide primers having a target-specific portion and a secondary primer-specific portion. Step 2 involves a secondary PCR phase where Taq polymerase is used to amplify the primary PCR extension products with oligonucleotide primers containing the same sequence as the secondary primer-specific portion of the primary PCR primers. The extension products resulting from the secondary PCR phase are subjected in step 3 to capillary electrophoresis or gel electrophoresis, followed by fluorescent quantification. The electrophoresis results in Figure 22 indicate the presence of both alleles (i.e., chromosomes) containing RB1 and NM23 and loss of heterozygosity (i.e., loss of allele on one chromosome) for p53.
  • Figure 23 is a schematic diagram depicting a primary PCR/secondary PCR process, according to the present invention, for detection of the loss of heterozygosity due to insertions and deletions in microsatellite repeats. The primary PCR phase in step 1 is initiated by denaturing the sample DNA at 94°C. Long PCR oligonucleotide primers, having 3' ends complementary to unique DNA surrounding microsatellite repeat sequences and 5' ends containing the same sequence as one of two primers utilized in the secondary PCR phase, are then caused to anneal to target DNA at 65°C. The primary PCR phase is carried out for 10-15 cycles. The long primers utilized in the primary PCR phase can be multiplexed as long as they do not amplify alleles with overlapping length ranges. These reactions must be carried out on tumor and corresponding normal DNA to identify informative (i.e. heterozygous) loci. In step 2 (i.e. secondary PCR amplification), primers containing the 5' ends of the primary PCR primers (one fluorescently labelled) are then used to amplify the primary PCR extension products at nearly equal efficiency. The secondary PCR extension products are then separated and analyzed by gel electrophoresis and an Applied Biosystems Inc. 373A DNA Sequencer using the Genescan 672 software package. Areas of loss of heterozygosity at informative loci are identified. The analysis in Figure 23 shows the presence of both alleles (i.e., chromosomes) containing RB1 and NM23 and loss of heterozygosity (i.e., loss of allele on one chromosome) for p53.
  • General Process Information
  • The ligase detection reaction is described generally in WO 90/17239 to Barany et al ., F. Barany et al., "Cloning, Overexpression and Nucleotide Sequence of a Thermostable DNA Ligase-encoding Gene," Gene, 109:1-11 (1991), and F. Barany, "Genetic Disease Detection and DNA Amplification Using Cloned Thermostable Ligase," Proc. Natl. Acad. Sci. USA, 88:189-193 (1991).
    The ligase detection reaction can use 2 sets of complementary oligonucleotides. This is known as the ligase chain reaction which is described in the 3 immediately preceding references. Alternatively, the ligase detection reaction can involve a single cycle which is known as the oligonucleotide ligation assay. See Landegren, et al., "A Ligase-Mediated Gene Detection Technique," Science 241: 1077-80 (1988); Landegren, et al., "DNA Diagnostics - Molecular Techniques and Automation," Science 242:229-37 (1988); and U.S. Patent No. 4,988,617 to Landegren, et al .
  • During ligase detection reaction phases, the denaturation treatment is carried out at a temperature of 80-105°C, while hybridization takes place at 50-85°C. Each cycle comprises a denaturation treatment and a thermal hybridization treatment which in total is from about one to five minutes long. Typically, the ligation detection reaction involves repeatedly denaturing and hybridizing for 2 to 50 cycles. The total time for the ligase detection reaction phase is 1 to 250 minutes.
  • The oligonucleotide probe sets or primers can be in the form of ribonucleotides, deoxynucleotides, modified ribonucleotides, modified deoxyribonucleotides, modified phosphate-sugar-backbone oligonucleotides, nucleotide analogs, and mixtures thereof.
  • In one variation, the oligonucleotides of the oligonucleotide probe sets each have a hybridization or melting temperature (i.e. Tm) of 66-70°C. These oligonucleotides are 20-28 nucleotides long.
  • The oligonucleotide probe sets or primers, as noted above, have a reporter label suitable for detection. Useful labels include chromophores, fluorescent moieties, enzymes, antigens, heavy metals, magnetic probes, dyes, phosphorescent groups, radioactive materials, chemiluminescent moieties, and electrochemical detecting moieties.
  • The polymerase chain reaction process is fully described in H. Erlick, et al., "Recent Advances in the Polymerase Chain Reaction," Science 252: 1643-50 (1991); M. Innis, et al., PCR Protocols: A Guide to Methods and Applications, Academic Press: New York (1990); and R. Saiki, et al., "Primer-directed Enzymatic Amplification of DNA with a Thermostable DNA Polymerase," Science 239: 487-91 (1988).
  • A particularly important aspect of the present invention is its capability to quantify the amount of target nucleotide sequence in a sample. This can be achieved in a number of ways by establishing standards which can be internal (i.e. where the standard establishing material is amplified and detected with the sample) or external (i.e. where the standard establishing material is not amplified, and is detected with the sample).
  • A wide variety of infectious diseases can be detected by the process of the present invention. Typically, these are caused by bacterial, viral, parasite, and fungal infectious agents. The resistance of various infectious agents to drugs can also be determined using the present invention.
  • Bacterial infectious agents which can be detected by the present invention include Escherichia coli, Salmonella, Shigella, Klebsiella, Pseudomonas, Listeria monocytogenes, Mycobacterium tuberculosis, Mycobacterium avium-introcellulare, Yersinia, Francisella, Pasteurella, Brucella, Clostridia, Bordetella pertussis, Bacteroides, Staphylococcus aureus, Streptococcus pneumonia, B-Hemolytic strep., Corynebacteria, Legionella, Mycoplasma, Ureaplasma, Chlamydia, Neisseria gonerrhea, Neisseria meningitides, Hemophilus influenza, Enterococcus faecalis, Proteus vulgaris, Proteus mirabilis, Helicobacter pylori, Treponema palladium, Borrelia burgdorferi, Borrelia recurrentis, Rickettsial pathogens, Nocardia, and Acitnomycetes.
  • Fungal infectious agents which can be detected by the present invention include Cryptococcus neoformans, Blastomyces dermatitidis, Histoplasma capsulatum, Coccidioides immitis, Paracoccidioides brasiliensis, Candida albicans, Aspergillus fumigautus, Phycomyceres (Rhizopus), Sporothrix schenckii, Chromomycosis, and Maduromycosis.
  • Viral infectious agents which can be detected by the present invention include human immunodeficiency virus, human T-cell lymphocytotrophic virus, hepatitis viruses (e.g., Hepatitis B Virus and Hepatitis C Virus), Epstein-Barr Virus, cytomegalovirus, human papillomaviruses, orthomyxo viruses, paramyxo viruses, adenoviruses, corona viruses, rhabdo viruses, polio viruses, toga viruses, bunya viruses, arena viruses, rubella viruses, and reo viruses.
  • Parasitic agents which can be detected by the present invention include Plasmodium falciparum, Plasmodium malaria, Plasmodium vivax, Plasmodium ovale, Onchoverva volvulus, Leishmania, Trypanosoma spp., Schistosoma spp., Entamoeba histolytica, Cryptosporidum, Giardia spp., Trichimonas spp., Balatidium coli, Wuchereria bancrofti, Toxoplasma spp., Enrerobius vermicularis, Ascaris lumbricoides, Trichuris trichiura, Dracunculus medinesis, trematodes, Diphyllobothrium latum, Taenia spp., Pneumocystis carinii, and Necator americanis.
  • The present invention is also useful for detection of drug resistance by infectious agents. For example, vancomycin-resistant Enterococcus faecium, methicillin-resistant Staphylococcus aureus, penicillin-resistant Streptococcus pneumoniae, multi-drug resistant Mycobacterium tuberculosis, and AZT-resistant human immunodeficiency virus can all be identified with the present invention.
  • Genetic diseases can also be detected by the process of the present invention. This can be carried out by prenatal or post-natal screening for chromosomal and genetic aberrations or for genetic diseases. Examples of detectable genetic diseases include: 21 hydroxylase deficiency, cystic fibrosis, Fragile X Syndrome, Turner Syndrome, Duchenne Muscular Dystrophy, Down Syndrome or other trisomies, heart disease, single gene diseases, HLA typing, phenylketonuria, sickle cell anemia, Tay-Sachs Disease, thalassemia, Klinefelter Syndrome, Huntington Disease, autoimmune diseases, lipidosis, obesity defects, henlophilia, inborn errors of metabolism, and diabetes.
  • Cancers which can be detected by the process of the present invention generally involve oncogenes, tumor suppressor genes, or genes involved in DNA amplification, replication, recombination, or repair. Examples of these include: BRCAI gene, p53 gene, APC gene, Her2/Neu amplification, Bcr/Ab1, K-ras gene, and human papillomavirus Types 16 and 18. Various aspects of the present invention can be used to identify amplifications, large deletions as well as point mutations and small deletions/insertions of the above genes in the following common human cancers: leukemia, colon cancer, breast cancer, lung cancer, prostate cancer, brain tumors, central nervous system tumors, bladder tumors, melanomas, liver cancer, osteosarcoma and other bone cancers, testicular and ovarian carcinomas, head and neck tumors, and cervical neoplasms.
  • In the area of environmental monitoring, the present invention can be used for detection, identification, and monitoring of pathogenic and indigenous microorganisms in natural and engineered ecosystems and microcosms such as in municipal waste water purification systems and water reservoirs or in polluted areas undergoing bioremediation. It is also possible to detect plasmids containing genes that can metabolize xenobiotics, to monitor specific target microorganisms in population dynamic studies, or either to detect, identify, or monitor genetically modified microorganisms in the environment and in industrial plants.
  • The present invention can also be used in a variety of forensic areas, including for human identification for military personnel and criminal investigation, paternity testing and family relation analysis, HLA compatibility typing, and screening blood, sperm, or transplantation organs for contamination.
  • In the food and feed industry, the present invention has a wide variety of applications. For example, it can be used for identification and characterization of production organisms such as yeast for production of beer, wine, cheese, yogurt, bread, etc. Another area of use is with regard to quality control and certification of products and processes (e.g., livestock, pasteurization, and meat processing) for contaminants. Other uses include the characterization of plants, bulbs, and seeds for breeding purposes, identification of the presence of plant-specific pathogens, and detection and identification of veterinary infections.
  • As noted supra, detection and quantification can be carried out using capillary or gel electrophoresis or on a solid support with an array capture oligonucleotides.
  • The use of capillary and gel electrophoresis for such purposes is well known. See e.g., Grossman, et al., "High-density Multiplex Detection of Nucleic Acid Sequences: Oligonucleotide Ligation Assay and Sequence-coded Separation," Nucl. Acids Res. 22(21): 4527-34 (1994).
  • The use of a solid support with an array of capture oligonucleotides is fully disclosed in pending provisional U.S. Patent Application published as US 6852487 . When using such arrays, the oligonucleotide primers used in the above-described coupled PCR phases, have an addressable array-specific portion. After the PCR phases are completed, the addressable array-specific portions for the products of such processes remain single stranded and are caused to hybridize to the capture oligonucleotides during a capture phase. C. Newton, et al., "The Production of PCR Products With 5' Single-Stranded Tails Using Primers That Incorporate Novel Phosphoramidite Intermediates, "Nucl. Acids Res. 21(5):1155-62 (1993).
  • During the capture phase of the process, the mixture is contacted with the solid support at a temperature of 45-90°C and for a time period of up to 60 minutes. Hybridizations may be accelerated by adding cations, volume exclusion or chaotropic agents. When an array consists of dozens to hundreds of addresses, it is important that the correct ligation product sequences have an opportunity to hybridize to the appropriate address. This may be achieved by the thermal motion of oligonucleotides at the high temperatures used, by mechanical movement of the fluid in contact with the array surface, or by moving the oligonucleotides across the array by electric fields. After hybridization, the array is washed sequentially with a low stringency wash buffer and then a high stringency wash buffer.
  • It is important to select capture oligonucleotides and addressable nucleotide sequences which will hybridize in a stable fashion. This requires that the oligonucleotide sets and the capture oligonucleotides be configured so that the oligonucleotides sets hybridize to the target nucleotide sequences at a termperature less than that which the capture oligonucleotides hybridize to the addressable array-specific portions. Unless the oligonucleotides are designed in this fashion, false positive signals may result due to capture of adjacent unreacted oligonucleotides from the same oligonucleotides set which are hybridized to the target.
  • The capture oligonucleotides can be in the form of ribonucleotides, deoxyribonucloetides, modified ribonucleotides, modified deoxyribonucleotides, peptide nucleotide analogues, modified peptide nucleotide analoges, modified phosphate-sugar backbone oligonucleotides, nucleotide analogues, and mixtures thereof.
  • Where an array is utilized, the detection phase of the process involves scanning and identifying if PCR products have been produced and correlating the presence of such products to a presence or absence of the target nucleotide sequence in the test sample. Scanning can be carried out by scanning electron microscopy, confocal microscopy, charge-coupled device, scanning tunnelling electron microscopy, infrared microscopy, atomic force microscopy, electrical conductance, and fluorescent or phosphor imaging. Correlating is carried out with a computer.
  • EXAMPLES Example 1 - Genomic DNA Preparation
  • Genomic DNA was prepared from the blood of two normal human volunteers, one male and one female, according to standard techniques. Briefly, approximately 12 ml of blood was obtained in EDTA-containing blood collection tubes. Red blood cells were lysed by mixing the blood samples with 4 volumes of lysis buffer (10 mM Tris pH 8.0, 10 mM EDTA). After 10 min on ice with occasional agitation, the suspensions were centrifuged and the supernatants were decanted. The white blood cell pellets were resuspended in 20 ml of lysis buffer, and the above process was repeated. Each cell pellet was then suspended in 15 ml of digestion buffer (50 mM Tris pH 8.0, 5 mM EDTA, 100 mM NaCl, 1 % SDS) and 3 mg (0.2 mg/ml) of proteinase K was added. The cells were digested at 37° C for 5 hours. The digests were extracted twice with equal volumes of phenol, then once with equal volumes of a 1:1 phenol:chloroform mixture and finally once with equal volumes of chloroform, each time centrifuging the mixture and removing the aqueous phase for the next extraction. After the final extraction and removing the aqueous phases, one tenth volume of 3 M sodium acetate, pH 6.5, was added. Two volumes of ice cold 100% EtOH were then added to each solution to precipitate the genomic DNAs, which were spooled out of solution on glass pipettes. The DNA precipitates were washed twice in 0.75 ml volumes of 70% EtOH, briefly centrifuging each time to allow removal of the supernatants. After removing the supernatants for the second time, the remaining EtOH was allowed to evaporate and the DNA was suspended in 0.5 ml of TE (10mM Tri-HCl pH 8.0 containing 1mM EDTA) solution. A fifth dilution of each DNA solution was also prepared in TE.
  • To determine the concentrations of the one fifth DNA solutions, 1, 2, and 4 µl aliquots of each were loaded on a 1% agarose gel with a known amount of HindIII digested lambda DNA as a control. The gel was run at 150 Volts for 2 hours with ethidium bromide in the electrophoresis buffer. After photographing the gel and comparing the intensities of the DNA bands, the one fifth dilutions were judged to have concentrations of approximately 100 ng/ml. DNA solutions extracted from various tumor cell lines were the generous gifts of other laboratories. The concentrations of these solutions were checked in a similar fashion and solutions of 100 ng/ml in TE were prepared.
  • To digest the genomic DNAs with Taq I, 25 µl of the 100 ng/µl solutions was mixed with 5 µl of 10X medium salt buffer (0.5 M NaCl, 0.1 M MgCl2, 0.1 M Tris, pH 8.0), 20 µl of water-ME (i.e. water containing 6mM ME (i.e., mercaptoethinol)), and 400 U of Taq I restriction endonuclease. The digests were covered with mineral oil and incubated at 65° C for 1 hour. The reactions were stopped by adding 1.2 µl of 500 mM EDTA and heating the specimens to 85° C for 10 min. Complete digestion of the DNAs was checked by electrophoresing aliquots on a 1% agarose gel.
  • Example 2 - Oligonucleotide Preparation for LDR Probes and PCR Primers
  • All oligonucleotides were synthesized on a 394A DNA Synthesizer (Applied Biosystems Division of Perkin-Elmer Corp., Foster City, CA.). Oligonucleotides labeled with 6-FAM were synthesized using the manufacturer's suggested modifications to the synthesis cycle (Applied Biosystems Inc., 1994) and were subsequently deprotected at 55° C for 4 hr. LDR oligonucleotides were purified by ethanol precipitation after overnight deprotection at 55° C. The primer-specific portions of the oligonucleotides used for PCR amplification were purified by polyacrylamide gel electrophoresis on 10% acrylamide/7M urea gels. Oligonucleotides were visualized after electrophoresis by UV shadowing against a lightening screen and excised from the gel (Applied Biosystems Inc., 1992). They were then eluted overnight at 64° C in TNE (i.e. Tris-sodium EDTA) buffer (100 mM Tris/HCl pH 8.0 containing 500 mM NaCl and 5 mM EDTA) and recovered from the eluate using Sep Pak cartridges (Millipore Corp, Milford, MA.) following the manufacture's instructions.
  • Oligonucleotides were resuspended in 100 µl THE (i.e. 10 mM Tri-HCl pH 8.0 containing 1mM EDTA). Typical concentrations of these original LDR probe solutions are about 1 µg/µl or approximately 74 pm/µl as determined by the following formula: concentration μg / μl X 10 6 / length nt X 325 = pm / μl
    Figure imgb0001
  • The concentrations of the LDR probes are given in Table 1. The concentrations of oligonucleotides complementary to the oligonucleotide probes of the ligase detection reaction were higher. ZipALg1F was 3.75 µg/µl and ZipBLg2R was 2.01 µg/µl or 524 pm/µl and 281 pm/µl, respectively, as determined by the formula above. Table 1
    Primer Length µg/µl pm/µl Vol=100pm I=200pm
    G6PDEx6-3L 48 nt 0.86 55.1 1.81 µl 3.63 µl
    G6PDEx6-4R 48 0.65 41.7 2.4 4.8
    ErbBEx1-5L 48 0.95 60.9 1.64 3.28
    ErbBEx1-5R 48 1.4025 89.9 1.11 2.22
    Int2Ex3-7L 50 1.6005 98.5 1.02 2.03
    Int2Ex3-8R 46 1.306 87.4 1.14 2.29
    p53Ex8-9L 2 1.036 61.3 1.63 3.26
    p53Ex8-10R 44 1.164 81.4 1.23 2.46
    SODEx3-11L 49 1.287 80.8 1.24 2.48
    SODEx3-12R 47 1.2045 78.9 1.27 2.53
  • As a prerequisite for the LDR phase, the downstream LDR oligonucleotides probes were phosphorylated with T4 polynucleotide kinase. Aliquots of the 5 downstream oligonucleotides equivalent to 200 pm (see Table 1) were combined with 10 µl of 10X kinase buffer (500 mM Tris/HCl pH 8.0, 100 mM MgCl2), 10 µl of 10 mM ATP, 20 U T4 kinase, and sufficient water-ME to give a final volume of 100 µl. Phosphorylation was carried out at 37° C for 30 min followed by incubation for 10 min at 85° C to inactivate the T4 enzyme. The resulting concentration of the kinased LDR probe solution was 2 pm/µl or 2000 fm/µl in each probe.
  • The kinase reaction is summarized as follows:
    4.8 µl G6PDEx6-4R
    2.2 µl ErbBEx1-5R
    2.3 µl Int2Ex3-8R
    2.5 µl p53Ex8-10R
    2.5 µl SODEx3-12R
    10 µl 10 x Kinase Buffer
    10 µ l 10 mMATP
    65.7 µl HOH + ME
    100 µl Total
    + 2 µl = 20 units T4 Kinase
    37° C for 30 min.
    Heat kill kinase, 85° C, 10 min.
    Final concentration = 2 pm/µl = 2000 fm/µl
  • The solutions of the LDR and PCR oligonucleotides were adjusted to convenient concentrations. The kinased LDR probe solution was diluted fourfold in water to yield a concentration of 500fm/µl. A solution of the upstream LDR probes was made by combining volumes of the probes equivalent to 200 pm (see Table 1) with sufficient water to give a final volume of 400 µl. This created a solution 500 fm/µl in each of the upstream LDR probes. Aliquots (20 µl) of the kinased and unkinased LDR probes were frozen for subsequent use. Standard solutions of the PCR primers (10 pm/µl) were prepared from their original solutions by combining 9.5 µl of ZipALg1F and 17.8 µl of ZipBLg2R with sufficient water to achieve a total volume of 500 µl. These solutions were frozen for use in the LDR/PCR process.
  • Unkinased probes were prepared according to the following:
    200 pm ea Primer
    3.62 µl G6PDEx6-3L
    3.28 µl ErbBEx1-5L
    2.04 µl Int2Ex3-7L
    3.26 µl p53Ex8-9L
    2.48 µl SODEx3-11L
    385.32 µl HOH
    400 µl Total Vol
    Final concentration = 0.5 pm/µ l = 500 fm/µ l Table 2 - Sequences
    Probe (length in nt)
    Gene Location Upstream Downstream Ligation Position
    erb 17q12-q21 erbBEx1-5L (48) erbBEx1-6R (48) exon "1" P40
    G6PD Xq28 G6PDEx6-3L (48) G6PDEx6-4R (48) exon 6 W1145
    Int2 11q13 Int2Ex3-7L (50) Int2Ex3-8R (46) exon 3 W135
    p53 17q13.1 p53Ex8-9L (52) p53Ex8-10R (44) exon 8 P51
    SOD 21q22.1 SODEx3-11L (49) SODEx3-12R (47) exon 3 P355
  • LDR oligonucleotide probes for quantification of gene amplications and deletions in the LDR/PCR process were designed to recognize exon 8 in the p53 tumor suppressor gene (on chromosome 17p), exon 3 of int-2 (on chromosome 11q), an internal exon in HER-2/neu (i.e. HER-2/neu/erbB oncogene) (on chromosome 17q), exon 3 in SOD (i.e. super oxide dismutase) (on chromosome 21q), and exon 6 in G6PD (i.e. glucose 6-phosphate dehydrogenase) (on chromosome Xq). Each pair of LDR oligonucleotide probes has the following features: (i) The left oligonucleotide probe contains from 5' to 3' an 18 base sequence identical to the fluorescently labeled secondary oligonucleotide primer (black bar), an "adjustment sequence" (white bar), and a target-specific sequence of from 22 to 28 bases with a Tm of 75°C (patterned bar); (ii) The right oligonucleotide probe contains from 5' to 3' a target-specific sequence of 20-25 bases with a Tm of 75°C (patterned bar), a single HaeIII or HinP1I restriction site at slightly different positions within the target-specific sequence, and an "adjustment sequence" (white bars). The two oligonucleotide probes are designed such that their combined length is exactly 96 bases, with 50 G+C bases and 46 A+T bases. The position of each unique restriction site generates a product which differs by at least 2 bases from the other products. Each oligonucleotide probe set has an exon-specific region chosen to ligate the junction sequence of (A, T)C↓C(A, T). This junction sequence corresponds to either a proline residue (codon CCN) or the complementary sequence of a tryptophan residue (TGG). These sequences were chosen to minimize differences in ligation rates and the chance of a polymorphism at the ligation junction.
  • LDR Probe Sequences
    • G6PDEx6-3L 5'CAC GCT ATC CCG TTA GAC ATT GTC AAG CAG GCG ATG TTG TCC CGG TTC 3'
    • G6PDEx6-4R 5'CAG ATG GGG CCG AAG ATC CTG TTA TTG ATA CAT AGT GCG GTA GTT GGC 3'
    • erbBEx1-5L 5'CAC GCT ATC CCG TTA CAC ATC GCC CTG ATG GGG AGA ATG TGA AAA TTC 3'
    • erbBEx1-6R 5'CAG TGG CCA TCA AAG TGT TGA GGG AGC CTA CAT AGT GCG GTA GTT GGC 3'
    • Int2Ex3-7L 3'CAC GCT ATC CCG TTA GAC ATT CAT AAC CCT TGC CGT TCA CAG ACA CGT AC 3'
    • Int2Ex3-8R 5'CAC AGT CTC TCG CCG CTG GGC AAT AAT ACA TAG TGC GGT AGT TGG C 3'
    • p53Ex8-9L 5'CAC GCT ATC CCG TTA GAC ATC TTA GTA ATT GAG GTG CGT GTT TGT GCC TGT C 3'
    • p53Ex8-10R 5'CTG GGA GAG ACC GGC GCA CAT TAC TAC ATA GTG CGG TAG TTG GC 3'
    • SODEx-3-11L 5'CAC GCT ATC CCG TTA GAC ATC TGT ACC AGT GCA GGT CCT CAC TTT AAT C 3'
    • SODEx-3-1ZR 5'CTC TAT CCA GAA AAC ACG GTG GGC CGC TAC ATA GTG CGG TAG TTG GC 3'
    PCR Primers:
  • ZipALg1F 5' Fam-GGA GCA CGC TAT CCC GTT AGA C 3' (Tm = 71°C)
    ZipBLg2R 5' CGC TGC CAA CTA CCG CAC TAT G 3' (Tm = 72°C)
  • (Underlined sequences are common between LDR probes and ZipALg1F or the complement of ZipBLg2R.)
  • Example 3 - Buffers and Reagents
    1. A. LDR Buffers/Reagents - the following LDR buffers and reagents were selected:
      • 10X ST ligase buffer (0.2 M Tris pH 8.5, 0.1 M MgCl2) (This was also tested with Tris at pH 7.6.]
      • 10 x TT ligase buffer (0.2 M Tris pH 7.6, 0.5 M KCI, 0.1 M MgCl2, 5mM EDTA)
      • NAD (10 mM)
      • DTT (200 mM)
      • LDR primer solution containing one tenth concentration of each of the LDR
        primer mixtures (50 fm of each LDR primer per µl)
      • Tth DNA Ligase (625 U/µl)
    2. B. PCR Buffers/Reagents - the following PCR buffers and reagents were selected:
      • 10X Stoffel buffer (0.1 M KCI, 0.1M Tris-HCl pH 8.3 Perkin Elmer)
      • dNTP solution (100mM total, 25mM of each dNTP Perkin Elmer), diluted 5 fold in dHOH to a final concentration of 5mM of each dNTP
      • ZipALg1F (10 pm/µl)
      • ZipBLg2R (10 pm/µl)
    Comparative example: Primary PCR/Secondary PCR/LDR Process Example 7 - Oligonucleotide Synthesis
  • Oligonucleotides were assembled by standard phosphoramidite chemistry on an Expedite DNA synthesizer (Perseptive Biosystems, Framingham, MA). Oliogonucleotides 5'-end labelled with 6-FAM, TET, and HEX were synthesized using the appropriate dye phosphoramidites (Perkin Elmer-Applied Biosystems) and purified with Oligonucloetide Purification Cartridges (Perkin Elmer-Applied Biosystems) following the manufacturer's protocol (Applied Biosystems Division-Perkin Elmer Corp., "Synthesis and Purification of Fluorescently Labeled Oligonucleotides Using Dye Phosphoramidites," User Bulletin, number 78, applied Biosystems Division, Foster City, CA, (1994)),. All oligonucleotides were checked for purity on an Applied Biosystems 270-HT capillary electrophoresis instrument using a mPAGE-3 column (J&W Scientific, Folsom, CA). Only oligonucleotides that were greater than 95% pure were used for the experiments. Oligonucleotides were resuspended in 250 ml TE (10mM Tris/HCl and 5 mM EDTA pH 8.0). Typical concentrations were 300-500 mM for crude stock solutions and 100-200 mM for OPC (i.e. Oligonucleotide Purification Columns available form Applied Biosystems) purified stock solutions. For PCR and LDR, oligonucleotides were diluted to working solutions of 10 mM (10 pmoles/ml) or 5mM (5 pmoles/ml).
  • Example 8 - Phosphorylation of LDR Oligonucleotides
  • The 12 LDR common oligonucleotides were phosphorylated at the 5' end to permit ligation to the fluorescent labeled oligonucleotides. The oligonucleotides are shown below in Table 9. Table 9 - LDR Oligonucleotide Sequences
    Locus Allele-Specific Oligonucleotide Common Oligonucleotide
    (5'→3') (5'→3')
    1 FAM-AGCTTCAATGATGAGAACCTGC P-GCATAGTGGTGGCTGACCTGTTCATAT
    TET-AGCTTCAATGATGAGAACCTGT
    2 FAM-CTCCATGGCCCCAGCC P-AGCACTGGTGCCCTGTGAG
    TET-CTCCATGGGCCCAGCT
    3 FAM-GGGGACAGCCATGCACTGA P-GCCTCTGGTAGCCTTTCAACCATA
    TET-GGGGACAGCCATGCACTGC
    4 FAMTTAGAAATCATCAAGCCTAGGTCAT P-CACCTTTTACCTTCCTGAGCAATGAT
    TET-TTAGAAATCATCAAGCCTAGGTCAG
    5 HEX-GGTTGTATTTGTCACCATATTAATTA P-ATTTTTCTCTATTGTTTTCATCTTTCAGGA
    HEX- AT GGTTGTATTTGTCACCATATTAATTG
    6 FAM-GGGCCAAGAAGGTATCTACCA P-ATAGTGTCTATTAGGCATTTGAAAATGTGTAT
    TET-GGGCCAAGAAGCTATCTACCG
    7 FAM-ACACAGCAGCTTACTCCAGAGG P-TCAAGTCCAAGGCCATTGGCTTATA
    TET-ACACAGCAGCTTACTCCAGAGA
    8 FAM-CCAGCAAAGAGAAAAGAAGGG P-CCCCAGAAATCACAGCTGGGCTAT
    TET-CCAGCAAAGAGAAAAGAAGGA
    9 FAM-ATGATATTAGAGCTCACTCATGTCCA P-TCAGTTTGGAAAAAGACAAAGAATTCTTT
    TET-ATGATATTAGAGCTCACTCATGTCCG
    10 HEX-TGCTGTCTTCCAGGAATCTGTT P-CAACTCTCTCGAAGCCATGTTCACAA
    HEX- AT TGCTGTCTTCCAGGAATCTGTG
    11 HEX-GGACATAGTGACCGTGCAGGTC P-CTTCCCCAGTGTGAGTGCCGTA
    HEX- AT GGACATAGTGACCGTGCAGGTT
    12 HEX-CTATGACACCGTCATCAGCAGG P-GACATCCAGGCCCCCGAC
    HEX-TACTATGACACCGTCATCAGCAGA
    The allele-specific oligonucleotides are 5' end labeled with either FAM, TEXT. or HEX. All the common oligonucleotides are phosphorylated at the 5' end. Underline denotes tails that are not complementary to the target sequence. LDR primer sets were designed in two ways: (i) allele-specific primers were of the same length but contained either FAM or TET label; or (ii) the allele-specific primers were both labeled with HEX but differed in length by two bases.
  • This was accomplished either during the synthesis with Phosphate-ON (Clontech Laboratories, Palo Alto, CA) according to the manufacturer's instructions or post-synthesis, using T4 polynucleotide kinase (Boehringer Mannheim, Indianapolis, IN). In the latter, a common oligomer was diluted into 50 µl of kinase buffer (50 mM Tris/HCl, 10 mM MgCl2, and 1 mM ATP) to a final concentration of 1 mM (500 pmol in 50 µl). Ten units of T4 kinase was added, and the reaction was incubated at 37°C for 30 min. The T4 kinase was inactivated by heating at 95°C for 10 min.
  • The kinase reaction was carried out as follows:
    10 µl 50 mM common oligo
    5 µl 10x kinase buffer
    5 µ l 10 mM ATP
    30 µl H2O
    50 µl Total
    + 1 µl T4 Kinase (10 units)
    37°C for 30 min.
    95°C for 10 min.
    Final concentration = 10 mM
  • Example 9 - Multiplex PCR Amplification
  • Twelve gene regions (2-13) were chosen for simultaneous PCR amplification based on information available in the Human Genome Database, as shown below in Table 10. Table 10 - List of Polymorphic Sites Analyzed
    Site Number Locus Symbol Locus Name Chr. Location Nucleotide Position Variation Het. Ref.
    1 CYP2D6 Cytochrome P450 IID 622q13.1 4469 (M33388) C,T .38 2
    2 AT3 Antithrombin III 1 q23-q25.1 7987 (X68793) C,T .46 3
    3 C6 Complement component C6 5p14-p12 185 (X72179) A,C .47 4
    4 IL1A Interleukin 1 alpha 2q13 6282 (X03833) T,G .34 5
    5 NF1 Neurofibromatosis 17q11.2 63683 (L05367) A,G .47 6
    6 ALDOB Aldolase B 9q22.3-q31 1087 (M 15656) A,G .50 7
    7 A2M Alpha 2 macroglobulin 12p13.3-p12.3 153 (X68731) G,A .42 8
    8 IGF2 Insulin growth factor 11p15.5 820 (X07868) G,A .46 9
    9 PROS1 Protein S alpha 3p11-cen 183 (M36564) A,G .50 10
    10 LIPC Triglyceride lipase 15q21-q23 113 (M29189) T,G .49 11
    11 CD18 Integrin B-2 subunit 21q22.3 109 (X64081) C,T .50 12
    12 LDLR Low density lipoprotein receptor 19p13.2 70 (L00344) G,A .50 13
  • The site numbers are specific single point variations located within the respective genes. All variations indicated are defined on the sense strand. Genbank accession numbers are indicated in parentheses. Chr., chromosome; Het, heterozygosity.
  • References in Table 10
  • Each region was well characterized and harbored a single-base variation with only two known alleles. PCR amplifications were performed using genomic DNA isolated from whole blood using a Purgene DNA Isolation Kit (Gentra Systems, Inc., Minneapolis, MI) according to the manufacturer's instructions.
  • A volume of 25 µl of PCR buffer (10 mM Tris/HCl pH 8.3, 10 mM KCl, 4 mM MgCl2, 0.4 mM each dNTP), 10-100 ng of genomic target DNA, PCR hybrid primer pairs 1-12 (2 pmol of each primer), and 1.3 units of AmpliTaq DNA polymerase Stoffel fragment (Applied Biosystems) was placed in a thin-walled MicroAmp reaction tube (Applied Biosystems). Each hybrid primer consisted of a gene-specific 3' region (16-29 bases) and a 5' region (22 bases) corresponding to one of two sets of universal (i.e. the portions which are primer-specific) primers (See Figure 4, where F1=Tet, F2=Fam, and F3=Het). These primers are shown in Table 11. TABLE 11 - Primary PCR Primer Sequences
    Number or Name Primer
    (5'->3')
    1 F GGAGCACGCTATCCCGTTAGACAGCCAAGGGGAACCCTGAGAG
    R CGCTGCCAACTACCGCACTATGATCGTGGTCGAGGTGGTCACCATC
    2 F CCTCGTTGCGAGGCGTATTCTGTATTTCCTCTTCTGTAAAAGGGAAGTTTGT
    R GCGACCTGACTTGCCGAAGAACATGTCCCATCTCCTCTACCTGATAC
    3 F GGAGCACGCTATCCCGTTAGACTAAAGATCTGTCTTGCGTCCCAGTCA
    RCGCTGCCAACTACCGCACTATGTATCAATTTTGCAGAGCTTAGATGGAATG
    4 F CCTCGTTGCGAGGCGTATTCTGTAGCACTTCTGATCATGGTTTTAGAAATC
    R GCGACCTGACTTGCCGAAGAACTATCGTATTTGATGATCCTCATAAAGTTG
    5 F GGAGCACGCTATCCCGTTAGACATCAGCCACTTGGAAGGAGCAAAC
    R CGCTGCCAACTACCGCACTATGATGGACCATGGCTGAGTCTCCTTTAG
    6 F CCTCGTTGCGAGGCGTATTCTG AACCAACACGGAGAAGCATTGTTTTC
    R GCGACCTGACTTGCCGAAGAACTATTAGCCTCAATCCTCATACTGACCTCTAC
    7 FGGAGCACGCTATCCCGTTAGACATCTCCTAACATCTATGTACTGGATTATCTAAATG
    R CGCTGCCAACTACCGCACTATGATCTTACTCAAGTAATCACTCACCAGTGTTG
    8 F CCTCGTTGCGAGGCGTATTCTGAATGAGTCAAATTGGCCTGGACTTG
    R GCGACCTGACTTGCCGAAGAACTTAATTCCCGTGAGAAGGGAGATG
    9 F CCTCGTTGCGAGGCGTATTCTGAAGGATCTGGATGAAGCCATTTCTAAAC
    R GCGACCTGACTTGCCGAAGAACTTGGAAAAGGTATTATAAGCAGAGAAAAGATG
    10 F GGAGCACGCTATCCCGTTAGACAGGACCGCAAAAGGCTTTCATC
    R CGCTGCCAACTACCGCACTATGTAGCACCCAGGCTGTACCCAATTAG
    11 F CCTCGTTGCGAGGCGTATTCTGATCGGGCGCTGGGCTTCAC
    RGCGACCTGACTTGCCGAAGAACATCAGATGCCGCACTCCAAGAAG
    12 F GGAGCACGCTATCCCGTTAGACATAAGAGCCCACGGCGTCTCTTC
    R CGCTGCCAACTACCGCACTATGTAAGAGACAGTGCCCAGGACAGAGTC
    ZipALg1 F GGAGCACGCTATCCCGTTAGAC
    ZipHLg2 R CGCTGCCAACTACCGCACAT G
    ZipCLg3 F CCTCGT GCGAGGCGTATTCT G
    ZipDLg4 R GCGACCTGACTTGCCGAAGAAC
    solid underline denote the ZipALg1 and ZipBLg2 sequences. Doned underline denotes the ZipCLg1 and ZipDLg2 sequences. Linker sequences are indicated in bold. F=forward. R=reverse.
    Forward and reverse hybrid primers for loci 1,3,5,7,10, and 12 contained 5' end regions identical to universal primers ALg1 and BLg2 respectively. Forward and reverse primers to loci 2,4,6,8,9, and 11 contained 5' end regions identical to universal primers CLg3 and DLg4, respectively. The rationale for using a low concentration of the hybrid primers in the PCR phase was to deplete the hybrid primers during the reaction. This would theoretically allow products with low amplification efficiencies to "catch up with" those that had high amplification efficiencies. Amplification was attained by thermal cycling for 1 cycle of 96°C for 15 sec to denature, then 15 cycles of 94°C for 15 sec to denature and 65°C for 60 sec to anneal and extend.
  • An equal volume of PCR buffer containing a high concentration of the two pairs of universal primers (25 pmol of each primer; Table 2) and 1.3 units of Amplitaq DNA polymerase Stoffel fragment was added to the Microamp reaction tube, and thermal cycling was performed for another 25 cycles with the annealing temperature lowered to 55°C. The upstream universal primers ALg1 and CLg3 were fluorescently labeled with 6-FAM and TET, respectively. All thermal cycling was achieved with a GeneAmp PCR System 9600 thermal cycler (Applied Biosystems).
    The primary PCR process was carried out under the following conditions:
    5.9 µl H2O
    5 µl primer pairs 1-12 (2 pmol each primer)
    2.5 µl 10X Stoffel fragment
    4 µl 25 mM MgCl 2
    5 µ l 2 mM dNTP stock (each)
    2.5 µl genomic DNA (10 ng)
    0.13 µl Stoffel Frag. (1.3 units)
    25 µl Total
    The primary PCR cycling conditions were as follows:
    • 96 °C 15"
    • 94 °C 15", 65 °C 1' x 15
    • 65 °C Hold
    The secondary PCR process was carried out under the following conditions:
    13.37 µl H2O
    5 µl zip primer pairs (25 pmol each primer)
    2.5 µl 10X Stoffel fragment
    4 µl 25 mM MgCl2
    0.13 µl Stoffel Frag (1.3 units)
    25 µl Total
    The secondary PCR cycling conditions were as follows:
    • 94 °C 15" , 55 °C 1' x 25
    • 4 °C Hold
  • The PCR products were separated on an Applied Biosystems 373 DNA sequencer. A 3 ml aliquot of PCR sample was mixed with 3 ml of formamide containing fluorescently labeled Genescan-2500 [TAMRA] size standard (Applied Biosystems). The formamide/standard solution was prepared by adding 50 ml Genescan-2500 size standard [TAMRA] to 450 ml of formamide. The sample was heated at 95°C for 2 min, quick cooled in ice, and electrophoresed through a denaturing 8% polyacrylamide gel in an Applied Biosystems 373 DNA sequencer running Genescan version 1.2 software. The sizes of the fluorescently labeled products were automatically computed by the Genescan analysis software using the local Southern method. The electropherograms clearly showed 12 distinct products (Figure 28). The uniform amount of each product was attributed to the similar size of each amplicon and the use of the primary primers with portions complementary to the secondary primers, which annealed with identical affinities to the 12 amplicons without the need to carefully adjust reaction conditions. The computed sizes of the products, which ranged from 135 to 175 bp, matched exactly to their actual sizes (see Table 12). Table 12 - List of PCR and LDR Products
    5m Number PCR Products LDR Product
    Label Size (bp) Label Size (bp) Variation Allele
    1 6-FAM 143 6-FAM 49 C A
    TET T B
    2 TET 145 6-FAM 35 C A
    TET T B
    3 6-FAM 147 6-FAM 43 A A
    TET C B
    4 TET 149 6-FAM 51 T A
    TET G B
    5 6-FAM 155 HEX 56 A A
    58 G B
    6 TET 157 6-FAM 53 A A
    TET G B
    7 6-FAM 159 6-FAM 47 G A
    TET A B
    8 TET 161 6-FAM 45 G A
    TET A B
    9 TET 165 6-FAM 55 A A
    TET G B
    10 6-FAM 167 HEX 48 T A
    50 G B
    11 TET 173 HEX 44 C A
    46 T B
    12 6-FAM 175 HEX 40 G A
    42 A B
    The dual labeling approach (Table 12) made it much easier to distinguish the products on the electropherograms (Figure 28, compare panel A with panels B and C).
  • Example 10 - Multiplex Ligase Detection Reaction
  • To avoid any possibility of labeled PCR product interfering with the detection of ligation product sequences, PCR product amplified using unlabeled PCR universal primers served as the target for the LDR. The polymerase in the PCR was inactivated by either freeze-thawing or adding EDTA/proteinase K to a final concentration of 5 mM and 100 mg/ml, respectively, and heating to 37°C for 30 min and 95°C for 10 min.
  • Proteinase K digestion was carried out under the following conditions:
    20 µl PCR product
    + 2.5 µl 500 mg/ml proteinase K
    25 µl Total
    60°C for 60 min.
    95°C for 10 min to heat kill proteinase K.
  • Four microliters of PCR product was diluted in 20 µl of LDR mix containing 50 mM Tris/HCl pH 8.5, 50 mM KCl, 10 mM MgCl 2 1 mM NAD+, 10 mM DTT, LDR oligonucleotide sets 1-12 (200 fmol of each oligonucleotide), and 10 units of Thermus aquaticus DNA ligase (Barany, F. and Gelfand, D., "Cloning, Overexpression, and Nucleotide Sequence of a Thermostable DNA Ligase-Encoding Gene," Gene, 109:1-11 (1991). Each LDR oligonucleotide probe set consisted of two allele-specific oligonucleotides and a common oligonucleotide. Each pair of discriminating allele-specific oligonucleotide probes in the LDR oligonucleotide probe sets 1,2,3,4,6,7,8 and 9 were the same size, with one oligonucleotide labeled with 6-FAM and the other labeled with TET. For LDR oligonucleotide probe sets 5, 10, 11 and 12, each pair of allele-specific oligonucleotides differed by 2 bases (the larger oligonucleotide had a 5' tail that was not complementary to the target sequence), and both oligonucleotides were labeled with HEX. Thermal cycling was performed for 1 cycle of 95°C for 2 min to denature, then 20 cycles of 95°C for 30 sec to denature, and 65°C for 4 min to ligate.
  • The LDR process was carried out as follows:
    4 µ l PCR product
    2 µl LDR oligo sets 1-12 (200 fmol each oligo)
    2 µl 10X T. ligase buffer
    2 µ l 10 mM NAD+
    1 µl 200 mM DTT
    9 µl H2O
    20 µl Total
    + 1 µl Taq Ligase (10 units)
    Stock of Ligase: 0.5 µl of 625 u/ml + 3.2 µl 10X buffer + 27.5 µl H2O
  • LDR cycling conditions were as follows:
    • 94 °C 2'
    • 94 °C 30", 65 °C 4' x 20
    • 4 °C Hold
  • A 3 µl aliquot of LDR sample was mixed with 3 µl of formamide containing fluorescently labeled Genescan-2500 [TAMRA] size standard (Applied Biosystems)). The sample was heated at 95°C for 2 min, quick cooled in ice, and electrophoresed through a denaturing 10% polyacrylamide gel in an Applied Biosystems 373 DNA sequencer running Genescan version 1.2 software. The sizes of the fluorescently labeled products were automatically computed by the Genescan analysis software using the local Southern method. LDR profiles of two individuals are shown in Figure 29. When each fluorescent dye was analyzed independently (Figure 29, panels B-D and F-H), it was very easy to determine the alleles present for each locus. A simple "A" or "B" code was assigned to each LDR product (Table 12) and used to score the genotypes. See Table 13 as follows: Table 13 - Genotypes Determined by PCR-LDR for 5 Individuals
    Individual Site Number
    1 2 3 4 5 6 7 8 9 10 11 12
    1 AB AB AB AB AB AB AB AA AA AB AB AB
    2 AA BB AB BB AB AB BB AA AB AA AA AA
    3 AB AB AB BB AA BB BB AA AA AB AB AA
    4 AA AB AA AB AB AA AB AA AB BB AB AA
    5 AA AA AA AB AB AB AB AB AA AB AB BB
  • The first individual (Figure 29A-D; Table 13, individual 1) was heterozygous at polymorphic sites 1-7, and 10-12. Heterozygosity at sites 1-4 and 6-7 was indicated by the detection of both 6-FAM and TET labeled products (Figure 29, panels B and C) at the respective positions on the electropherograms. Heterozygosity at sites 5 and 11-12 was indicated by the presence of two HEX labeled products, differing in size by 2 bases, for each of these loci (Figure 29, panel D). In contrast, the one product detected at sites 8 and 9 (Figure 29, panels B and C) established that each of these loci was homozygous. The second individual (Figure 29E-F and G-H; Table 13, individual 2) was heterozygous only at sites 3,5,6 and 9 and homozygous at sites 1, 2, 4, 7, 8, 10-12. There was a total of 8 differences in the genotypes at these positions between the two persons. Three additional individuals were typed, and all 5 persons had distinct genotypes based on the 12 loci (Table 13).

Claims (2)

  1. A method for identifying two or more of a plurality of sequences differing by one or more insertions or deletions in a plurality of target nucleotide sequences comprising:
    providing a sample potentially containing two or more of a plurality of sequences differing by one or more insertions or deletions in a plurality of target nucleotide sequences;
    providing one or more primary oligonucleotide primer groups, each group comprised of more than one primary oligonucleotide primer sets, each set characterized by (a) a first oligonucleotide primer, having a target-specific portion and a 5' upstream secondary primer-specific portion, and (b) a second oligonucleotide primer, having a target-specific portion and a 5' upstream secondary primer-specific portion, wherein the first oligonucleotide primers of each set in the same group contain the same 5' upstream secondary primer-specific portion and the second oligonucleotide primers of each set in the same group contain the same 5' upstream secondary primer-specific portion, wherein the oligonucleotide primers in a particular set are suitable for hybridization on complementary strands of a corresponding target nucleotide sequence to permit formation of a polymerase chain reaction product, but have a mismatch which interferes with formation of such a polymerase chain reaction product when hybridized to any other nucleotide sequence present in the sample, and wherein the polymerase chain reaction products in a particular set may be distinguished from other polymerase chain reaction products in the same group or other groups;
    providing a polymerase;
    blending the sample, the primary oligonucleotide primers, and the polymerase to form a primary polymerase chain reaction mixture;
    subjecting the primary polymerase chain reaction mixture to two or more polymerase chain reaction cycles comprising a denaturation treatment, wherein hybridized nucleic acid sequences are separated, a hybridization treatment, wherein the target-specific portion of the primary oligonucleotide primers hybridize to the target nucleotide sequences, and an extension treatment, wherein the hybridized primary oligonucleotide primers are extended to form primary extension products complementary to each of the two or more of a plurality of sequences differing by one or more insertions or deletions in the plurality of target nucleotide sequences to which the primary oligonucleotide primer is hybridized;
    providing one or a plurality of secondary oligonucleotide primer sets, each set characterized by (a) a first secondary primer, having a detectable reporter label and containing the same sequence as the 5' upstream portion of a first primary oligonucleotide primer, and (b) a second secondary primer containing the same sequence as the 5' upstream portion of a second primary oligonucleotide primer from the same primary oligonucleotide primer set as the first primary oligonucleotide primer sequence contained by the first secondary primer, wherein a set of secondary oligonucleotide primers amplify the primary extension products in a given group;
    blending the primary extension products, the secondary oligonucleotide primers, and the polymerase to form a secondary polymerase chain reaction mixture; subjecting the secondary polymerase chain reaction mixture to two or more polymerase chain reaction cycles comprising a denaturation treatment, wherein hybridized nucleic sequences are separated, a hybridization treatment, wherein the secondary oligonucleotide primers hybridize to the primary extension products, an extension treatment, wherein the hybridized secondary oligonucleotide primers are extended to form secondary extension products complementary to each of the primary extension products; wherein the polymerase chain reaction secondary oligonucleotide primers in a particular set produce secondary extension products of unique length so that they may be distinguished from other nucleic acids in the secondary polymerase chain reaction mixture, said method further comprising:
    separating the extension products by size or electrophoretic mobility and
    distinguishing the secondary extension products which differ in size; and
    detecting the labeled secondary extension products, thereby indicating the presence of two or more of a plurality of sequences differing by one or more insertions or deletions in a plurality of target nucleotide sequences.
  2. A method according to claim 1, wherein the secondary extension products contain unique sequences so that they may be distinguished from other secondary extension products, said method further comprising:
    providing a solid support with different capture oligonucleotides immobilized at different particular sites, wherein the capture oligonucleotides have nucleotide sequences complementary to the unique nucleotide sequences within the secondary extension products;
    contacting the secondary polymerase chain reaction mixture, after said subjecting it to one or more polymerase chain reaction cycles, with the solid support under conditions effective to hybridize the secondary extension products to the capture oligonucleotides in a base-specific manner, thereby capturing the secondary extension products to the solid support at the site with complementary capture oligonucleotides, wherein said detecting indicates the presence of secondary extension products captured using the unique nucleotide sequence portions within the secondary extension products and immobilized to the solid support at particular sites, thereby indicating the presence of one or more target nucleotide sequences in the sample.
EP06011667.0A 1996-05-29 1997-05-27 Detection of nucleic acid sequence differences using coupled ligase detection and polymerase chain reactions Expired - Lifetime EP1736554B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP10075461.3A EP2369007B1 (en) 1996-05-29 1997-05-27 Detection of nucleic acid sequence differences using coupled ligase detection and polymerase chain reactions

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US1853296P 1996-05-29 1996-05-29
EP97927787A EP0912761A4 (en) 1996-05-29 1997-05-27 DETECTION OF DIFFERENCES IN NUCLEIC ACID SEQUENCES USING A COMBINATION OF LIGASE DETECTION AND POLYMERASE CHAIN AMPLIFICATION REACTIONS

Related Parent Applications (2)

Application Number Title Priority Date Filing Date
EP97927787A Division EP0912761A4 (en) 1996-05-29 1997-05-27 DETECTION OF DIFFERENCES IN NUCLEIC ACID SEQUENCES USING A COMBINATION OF LIGASE DETECTION AND POLYMERASE CHAIN AMPLIFICATION REACTIONS
EP97927787.8 Division 1997-12-04

Related Child Applications (4)

Application Number Title Priority Date Filing Date
EP10075461.3A Division EP2369007B1 (en) 1996-05-29 1997-05-27 Detection of nucleic acid sequence differences using coupled ligase detection and polymerase chain reactions
EP10075461.3 Division-Into 2010-09-17
EP10075462.1 Division-Into 2010-09-17
EP10075550.3 Division-Into 2010-09-29

Publications (3)

Publication Number Publication Date
EP1736554A2 EP1736554A2 (en) 2006-12-27
EP1736554A3 EP1736554A3 (en) 2007-02-21
EP1736554B1 true EP1736554B1 (en) 2013-10-09

Family

ID=21788414

Family Applications (3)

Application Number Title Priority Date Filing Date
EP06011667.0A Expired - Lifetime EP1736554B1 (en) 1996-05-29 1997-05-27 Detection of nucleic acid sequence differences using coupled ligase detection and polymerase chain reactions
EP97927787A Withdrawn EP0912761A4 (en) 1996-05-29 1997-05-27 DETECTION OF DIFFERENCES IN NUCLEIC ACID SEQUENCES USING A COMBINATION OF LIGASE DETECTION AND POLYMERASE CHAIN AMPLIFICATION REACTIONS
EP10075461.3A Expired - Lifetime EP2369007B1 (en) 1996-05-29 1997-05-27 Detection of nucleic acid sequence differences using coupled ligase detection and polymerase chain reactions

Family Applications After (2)

Application Number Title Priority Date Filing Date
EP97927787A Withdrawn EP0912761A4 (en) 1996-05-29 1997-05-27 DETECTION OF DIFFERENCES IN NUCLEIC ACID SEQUENCES USING A COMBINATION OF LIGASE DETECTION AND POLYMERASE CHAIN AMPLIFICATION REACTIONS
EP10075461.3A Expired - Lifetime EP2369007B1 (en) 1996-05-29 1997-05-27 Detection of nucleic acid sequence differences using coupled ligase detection and polymerase chain reactions

Country Status (6)

Country Link
US (18) US6027889A (en)
EP (3) EP1736554B1 (en)
JP (3) JP4468488B2 (en)
AU (1) AU730633B2 (en)
CA (1) CA2255774C (en)
WO (1) WO1997045559A1 (en)

Families Citing this family (813)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5744101A (en) 1989-06-07 1998-04-28 Affymax Technologies N.V. Photolabile nucleoside protecting groups
US5547839A (en) 1989-06-07 1996-08-20 Affymax Technologies N.V. Sequencing of surface immobilized polymers utilizing microflourescence detection
US6955915B2 (en) 1989-06-07 2005-10-18 Affymetrix, Inc. Apparatus comprising polymers
US6919211B1 (en) 1989-06-07 2005-07-19 Affymetrix, Inc. Polypeptide arrays
US6652808B1 (en) * 1991-11-07 2003-11-25 Nanotronics, Inc. Methods for the electronic assembly and fabrication of devices
WO1993017126A1 (en) * 1992-02-19 1993-09-02 The Public Health Research Institute Of The City Of New York, Inc. Novel oligonucleotide arrays and their use for sorting, isolating, sequencing, and manipulating nucleic acids
US5710000A (en) * 1994-09-16 1998-01-20 Affymetrix, Inc. Capturing sequences adjacent to Type-IIs restriction sites for genomic library mapping
USRE43097E1 (en) 1994-10-13 2012-01-10 Illumina, Inc. Massively parallel signature sequencing by ligation of encoded adaptors
WO1998053300A2 (en) * 1997-05-23 1998-11-26 Lynx Therapeutics, Inc. System and apparaus for sequential processing of analytes
US6852487B1 (en) * 1996-02-09 2005-02-08 Cornell Research Foundation, Inc. Detection of nucleic acid sequence differences using the ligase detection reaction with addressable arrays
US20020150921A1 (en) * 1996-02-09 2002-10-17 Francis Barany Detection of nucleic acid sequence differences using the ligase detection reaction with addressable arrays
US6881571B1 (en) * 1998-03-11 2005-04-19 Exonhit Therapeutics S.A. Qualitative differential screening
US6458530B1 (en) 1996-04-04 2002-10-01 Affymetrix Inc. Selecting tag nucleic acids
JP4034351B2 (en) 1996-04-25 2008-01-16 バイオアレイ ソリューションズ エルエルシー Light-controlled electrokinetic assembly of particle-proximal surfaces
EP1736554B1 (en) * 1996-05-29 2013-10-09 Cornell Research Foundation, Inc. Detection of nucleic acid sequence differences using coupled ligase detection and polymerase chain reactions
US6312892B1 (en) 1996-07-19 2001-11-06 Cornell Research Foundation, Inc. High fidelity detection of nucleic acid differences by ligase detection reaction
JP3142879B2 (en) * 1996-09-13 2001-03-07 株式会社分子バイオホトニクス研究所 Solid phase for detecting target nucleic acid, method for producing the same, and method for detecting target nucleic acid
GB9624165D0 (en) * 1996-11-19 1997-01-08 Amdex A S Use of nucleic acids bound to carrier macromolecules
CA2389358C (en) * 1996-12-31 2008-07-15 Genometrix Incorporated Multiplexed molecular analysis apparatus and method
US7622294B2 (en) 1997-03-14 2009-11-24 Trustees Of Tufts College Methods for detecting target analytes and enzymatic reactions
US6327410B1 (en) 1997-03-14 2001-12-04 The Trustees Of Tufts College Target analyte sensors utilizing Microspheres
US20030027126A1 (en) 1997-03-14 2003-02-06 Walt David R. Methods for detecting target analytes and enzymatic reactions
EP2327797B1 (en) 1997-04-01 2015-11-25 Illumina Cambridge Limited Method of nucleic acid sequencing
US6143496A (en) * 1997-04-17 2000-11-07 Cytonix Corporation Method of sampling, amplifying and quantifying segment of nucleic acid, polymerase chain reaction assembly having nanoliter-sized sample chambers, and method of filling assembly
US7115884B1 (en) 1997-10-06 2006-10-03 Trustees Of Tufts College Self-encoding fiber optic sensor
US6607878B2 (en) 1997-10-06 2003-08-19 Stratagene Collections of uniquely tagged molecules
US7348181B2 (en) * 1997-10-06 2008-03-25 Trustees Of Tufts College Self-encoding sensor with microspheres
GB9725197D0 (en) * 1997-11-29 1998-01-28 Secr Defence Detection system
US7569342B2 (en) 1997-12-10 2009-08-04 Sierra Molecular Corp. Removal of molecular assay interferences
US20030096232A1 (en) * 1997-12-19 2003-05-22 Kris Richard M. High throughput assay system
US20100105572A1 (en) * 1997-12-19 2010-04-29 Kris Richard M High throughput assay system
US20030039967A1 (en) * 1997-12-19 2003-02-27 Kris Richard M. High throughput assay system using mass spectrometry
US20020177144A1 (en) * 1997-12-30 2002-11-28 Jose Remacle Detection and/or quantification method of a target molecule by a binding with a capture molecule fixed on the surface of a disc
US20050053962A1 (en) * 1998-01-27 2005-03-10 Gary Blackburn Amplification of nucleic acids with electronic detection
US6759192B1 (en) * 1998-06-05 2004-07-06 Genset S.A. Polymorphic markers of prostate carcinoma tumor antigen-1(PCTA-1)
JP3662850B2 (en) * 1998-06-24 2005-06-22 イルミナ インコーポレイテッド Decoding array sensors with microspheres
US20040203078A1 (en) * 1998-07-22 2004-10-14 National Institute Of Advanced Industrial Science And Technology Labeled complex, process for producing same and process for utilizing same
US6703228B1 (en) 1998-09-25 2004-03-09 Massachusetts Institute Of Technology Methods and products related to genotyping and DNA analysis
EP1001037A3 (en) * 1998-09-28 2003-10-01 Whitehead Institute For Biomedical Research Pre-selection and isolation of single nucleotide polymorphisms
US6949370B1 (en) 1998-10-30 2005-09-27 Cornell Research Foundation, Inc. High fidelity thermostable ligase and uses thereof
DE69911641T2 (en) * 1998-11-27 2004-08-05 Synaptics (Uk) Ltd., Harston POSITION SENSOR
EP1161563A2 (en) 1999-03-15 2001-12-12 PE Corporation (NY) Probe/mobility modifier complexes for multiplex nucleic acid detection
JP4601830B2 (en) * 1999-03-19 2010-12-22 コーネル リサーチ ファンデーション インク. Coupled polymerase chain reaction-restriction endonuclease digestion-ligase detection reaction method
US7014994B1 (en) 1999-03-19 2006-03-21 Cornell Research Foundation,Inc. Coupled polymerase chain reaction-restriction-endonuclease digestion-ligase detection reaction process
US6506594B1 (en) * 1999-03-19 2003-01-14 Cornell Res Foundation Inc Detection of nucleic acid sequence differences using the ligase detection reaction with addressable arrays
US6355431B1 (en) 1999-04-20 2002-03-12 Illumina, Inc. Detection of nucleic acid amplification reactions using bead arrays
US20060275782A1 (en) * 1999-04-20 2006-12-07 Illumina, Inc. Detection of nucleic acid reactions on bead arrays
US20030207295A1 (en) * 1999-04-20 2003-11-06 Kevin Gunderson Detection of nucleic acid reactions on bead arrays
US20030096321A1 (en) * 1999-05-19 2003-05-22 Jose Remacle Method for the identification and/or the quantification of a target compound obtained from a biological sample upon chips
US7056661B2 (en) 1999-05-19 2006-06-06 Cornell Research Foundation, Inc. Method for sequencing nucleic acid molecules
US6544732B1 (en) 1999-05-20 2003-04-08 Illumina, Inc. Encoding and decoding of array sensors utilizing nanocrystals
WO2000075373A2 (en) 1999-05-20 2000-12-14 Illumina, Inc. Combinatorial decoding of random nucleic acid arrays
US8481268B2 (en) 1999-05-21 2013-07-09 Illumina, Inc. Use of microfluidic systems in the detection of target analytes using microsphere arrays
US8080380B2 (en) * 1999-05-21 2011-12-20 Illumina, Inc. Use of microfluidic systems in the detection of target analytes using microsphere arrays
JP3911909B2 (en) * 1999-06-09 2007-05-09 株式会社日立製作所 DNA sample preparation method and DNA sample preparation apparatus
US20020119448A1 (en) 1999-06-23 2002-08-29 Joseph A. Sorge Methods of enriching for and identifying polymorphisms
EP1194592B1 (en) * 1999-07-14 2008-09-24 Packard Bioscience Company Derivative nucleic acids and uses thereof
US6964847B1 (en) 1999-07-14 2005-11-15 Packard Biosciences Company Derivative nucleic acids and uses thereof
US7482443B2 (en) * 2000-03-09 2009-01-27 Genetag Technology, Inc. Systems and methods to quantify and amplify both signaling probes for cDNA chips and genes expression microarrays
US6692915B1 (en) 1999-07-22 2004-02-17 Girish N. Nallur Sequencing a polynucleotide on a generic chip
AU775380B2 (en) 1999-08-18 2004-07-29 Illumina, Inc. Compositions and methods for preparing oligonucleotide solutions
JP4267233B2 (en) * 1999-09-10 2009-05-27 ジェロン・コーポレーション Oligonucleotides N3 '→ P5' thiophosphoramidates: their synthesis and use
BR0014182A (en) 1999-09-13 2002-05-21 Nugen Technologies Inc Processes and compositions for linear isothermal amplification of polynucleotide sequences
US6692918B2 (en) 1999-09-13 2004-02-17 Nugen Technologies, Inc. Methods and compositions for linear isothermal amplification of polynucleotide sequences
FR2798673B1 (en) * 1999-09-16 2004-05-28 Exonhit Therapeutics Sa METHODS AND COMPOSITIONS FOR DETECTION OF PATHOLOGICAL EVENTS
WO2001025481A1 (en) 1999-10-04 2001-04-12 Olympus Optical Co., Ltd. Method of detecting nucleic acid
JP3668075B2 (en) * 1999-10-12 2005-07-06 光夫 板倉 Suspension system for determining genetic material sequence, method for determining genetic material sequence using the suspension system, and SNPs high-speed scoring method using the suspension system
AU2001234608A1 (en) * 2000-01-28 2001-08-07 Genetrace Systems, Inc. Methods for analysis of gene expression
US7582420B2 (en) 2001-07-12 2009-09-01 Illumina, Inc. Multiplex nucleic acid reactions
US7611869B2 (en) 2000-02-07 2009-11-03 Illumina, Inc. Multiplexed methylation detection methods
US6812005B2 (en) 2000-02-07 2004-11-02 The Regents Of The University Of California Nucleic acid detection methods using universal priming
US7361488B2 (en) 2000-02-07 2008-04-22 Illumina, Inc. Nucleic acid detection methods using universal priming
US7955794B2 (en) 2000-09-21 2011-06-07 Illumina, Inc. Multiplex nucleic acid reactions
US8076063B2 (en) * 2000-02-07 2011-12-13 Illumina, Inc. Multiplexed methylation detection methods
US20020006617A1 (en) * 2000-02-07 2002-01-17 Jian-Bing Fan Nucleic acid detection methods using universal priming
US20050214825A1 (en) * 2000-02-07 2005-09-29 John Stuelpnagel Multiplex sample analysis on universal arrays
US6913884B2 (en) * 2001-08-16 2005-07-05 Illumina, Inc. Compositions and methods for repetitive use of genomic DNA
US6770441B2 (en) * 2000-02-10 2004-08-03 Illumina, Inc. Array compositions and methods of making same
US20020039728A1 (en) * 2000-02-10 2002-04-04 Robert Kain Alternative substrates and formats for bead-based array of arrays
EP1130113A1 (en) * 2000-02-15 2001-09-05 Johannes Petrus Schouten Multiplex ligation dependent amplification assay
ATE412774T1 (en) * 2000-02-16 2008-11-15 Illumina Inc PARALLEL GENOTYPING OF MULTIPLE PATIENT SAMPLES
DE10010281B4 (en) * 2000-02-25 2005-03-10 Epigenomics Ag Ligase / polymerase method for the detection of cytosine methylation in DNA samples
US6368801B1 (en) 2000-04-12 2002-04-09 Molecular Staging, Inc. Detection and amplification of RNA using target-mediated ligation of DNA by RNA ligase
EP1303639A2 (en) 2000-04-14 2003-04-23 Cornell Research Foundation, Inc. Method of designing addressable array for detection of nucleic acid sequence differences using ligase detection reaction
WO2001085987A1 (en) * 2000-05-09 2001-11-15 Diatech Pty. Ltd. Methods for identifying polynucleotide repeat regions of defined length
AU2001265121A1 (en) * 2000-05-30 2001-12-11 Applera Corporation Methods for detecting target nucleic acids using coupled ligation and amplification
US7087414B2 (en) 2000-06-06 2006-08-08 Applera Corporation Methods and devices for multiplexing amplification reactions
AU7299301A (en) * 2000-06-21 2002-01-02 Bioarray Solutions Ltd Multianalyte molecular analysis using application-specific random particle arrays
US9709559B2 (en) 2000-06-21 2017-07-18 Bioarray Solutions, Ltd. Multianalyte molecular analysis using application-specific random particle arrays
US7846733B2 (en) * 2000-06-26 2010-12-07 Nugen Technologies, Inc. Methods and compositions for transcription-based nucleic acid amplification
EP1356094B1 (en) 2000-06-26 2010-01-13 Nugen Technologies, Inc. Methods and compositions for transcription-based nucleic acid amplification
AU7637601A (en) * 2000-07-01 2002-01-14 Clondiag Chip Tech Gmbh Method for qualitative and/or quantitative detecting of molecular interactions on probe arrays
CA2415125A1 (en) * 2000-07-03 2002-01-10 Applera Corporation Polynucleotide sequence assay
JP4310599B2 (en) * 2000-07-05 2009-08-12 東洋紡績株式会社 Method for detecting nucleotide polymorphisms
SG144729A1 (en) * 2000-07-06 2008-08-28 Bio Merieux Method for controlling the microbiological quality of an aqueous medium and kit therefor
US20050260574A1 (en) * 2000-07-27 2005-11-24 Gibbs Mark J Combinatorial probes and uses therefor
WO2002016645A2 (en) * 2000-08-21 2002-02-28 Lynx Therapeutics, Inc. Polymorphic dna fragments and uses thereof
US20050239125A1 (en) * 2000-09-06 2005-10-27 Hodge Timothy A Methods for genotype screening
US20050272085A1 (en) * 2000-09-06 2005-12-08 Hodge Timothy A Methods for forensic and congenic screening
EP1978110B1 (en) * 2000-09-06 2010-05-26 Transnetyx, Inc. Computer-based method and system for screening genomic DNA
US20030207289A1 (en) * 2001-09-04 2003-11-06 Hodge Timothy A. Detection of genetic sequences using a bipartite probe
US20040185464A1 (en) * 2000-09-15 2004-09-23 Kris Richard M. High throughput assay system
DE10048944A1 (en) * 2000-10-03 2002-04-18 Andreas Kage Process for the selection of nucleic acids that bind highly affine to a target by two-dimensional separation
DE60131903T2 (en) * 2000-10-24 2008-11-27 The Board of Trustees of the Leland S. Stanford Junior University, Palo Alto DIRECT MULTIPLEX CHARACTERIZATION OF GENOMIC DNA
US20040018491A1 (en) * 2000-10-26 2004-01-29 Kevin Gunderson Detection of nucleic acid reactions on bead arrays
JP2004534203A (en) * 2000-11-30 2004-11-11 ボストン プローブス,インコーポレイテッド Methods and compositions for the classification and / or determination of microorganisms
EP1427847B1 (en) * 2000-12-13 2010-07-28 Nugen Technologies, Inc. Methods and compositions for generation of multiple copies of nucleic acid sequences and methods of detection thereof
US6312929B1 (en) * 2000-12-22 2001-11-06 Cepheid Compositions and methods enabling a totally internally controlled amplification reaction
CA2433674A1 (en) * 2001-01-05 2002-07-11 Invitrogen Corporation Method for relative quantification of attached nucleic acids
FI115139B (en) * 2001-01-10 2005-03-15 Valtion Teknillinen Method and test package for quantitative and / or comparative assessment of the variations of polynucleotide amounts in cell or tissue samples
EP1229128A1 (en) * 2001-01-31 2002-08-07 Boehringer Mannheim Gmbh New method for genotype determination
AU2002250066A1 (en) * 2001-02-12 2002-08-28 Rosetta Inpharmatics, Inc. Confirming the exon content of rna transcripts by pcr using primers complementary to each respective exon
WO2003012147A1 (en) * 2001-02-20 2003-02-13 Datascope Investment Corp. Method for reusing standard blots and microarrays utilizing dna dendrimer technology
JP2005508135A (en) 2001-03-09 2005-03-31 ニューゲン テクノロジーズ, インコーポレイテッド Methods and compositions for amplification of RNA sequences
JP4542312B2 (en) 2001-03-09 2010-09-15 ニューゲン テクノロジーズ, インコーポレイテッド Methods and compositions for amplification of RNA sequences
EP1247815A3 (en) * 2001-03-25 2003-01-29 Exiqon A/S Modified oligonucleotides and uses thereof
US7029919B2 (en) * 2001-05-04 2006-04-18 Agilent Technologies, Inc. Electro-optical device and methods for hybridization and detection
US20030104421A1 (en) * 2001-05-07 2003-06-05 Colangelo Christopher M. Methods and compositions for nucleic acid amplification
WO2004059289A2 (en) * 2001-05-22 2004-07-15 Epicentre Technologies Target-dependent transcription using deletion mutants of n4 rna polymerase
GB0112868D0 (en) * 2001-05-25 2001-07-18 Secr Defence Detection system
DE10126630A1 (en) * 2001-05-31 2003-01-09 Peter Und Traudl Engelhorn Sti Cell sorting method
CA2450139A1 (en) * 2001-06-11 2002-12-19 Illumina, Inc Multiplexed detection methods
US7262063B2 (en) 2001-06-21 2007-08-28 Bio Array Solutions, Ltd. Directed assembly of functional heterostructures
EP1409738A4 (en) * 2001-06-22 2005-03-30 Marshfield Clinic METHODS AND OLIGONUCLEOTIDES FOR THE DETECTION OF SALMONELLA SP., E. COLI O157: H7, AND LISTERIA MONOCYTOGENES
US20030170695A1 (en) * 2001-06-29 2003-09-11 Liang Shi Enzymatic ligation-based identification of nucleotide sequences
US20030082584A1 (en) * 2001-06-29 2003-05-01 Liang Shi Enzymatic ligation-based identification of transcript expression
US7473767B2 (en) 2001-07-03 2009-01-06 The Institute For Systems Biology Methods for detection and quantification of analytes in complex mixtures
WO2003006677A2 (en) * 2001-07-12 2003-01-23 Illumina, Inc. Multiplex nucleic acid reactions
WO2003062783A2 (en) * 2001-07-20 2003-07-31 North Carolina State University Light addressable electrochemical detection of duplex structures
US20030096277A1 (en) * 2001-08-30 2003-05-22 Xiangning Chen Allele specific PCR for genotyping
US20060014186A1 (en) * 2001-09-04 2006-01-19 Hodge Timothy A Methods for genotype screening of a strain disposed on an adsorbent carrier
US7153656B2 (en) * 2001-09-11 2006-12-26 Los Alamos National Security, Llc Nucleic acid sequence detection using multiplexed oligonucleotide PCR
EP1436424A4 (en) * 2001-09-18 2005-11-16 Us Genomics Inc Differential tagging of polymers for high resolution linear analysis
EP1438416A4 (en) * 2001-09-26 2007-09-05 Epigenx Pharmaceutical Inc Assays for dna methylation changes
US20070264641A1 (en) * 2001-10-15 2007-11-15 Li Alice X Multiplexed analysis of polymorphic loci by concurrent interrogation and enzyme-mediated detection
CN100494395C (en) * 2001-10-15 2009-06-03 生物芯片技术有限公司 polymorphic locus multiplexed analysis by concurrent probing and enzyme-mediated detection
JP3829690B2 (en) * 2001-10-30 2006-10-04 株式会社日立製作所 Nucleic acid sequence inspection method
US7510829B2 (en) 2001-11-19 2009-03-31 Affymetrix, Inc. Multiplex PCR
US20110151438A9 (en) 2001-11-19 2011-06-23 Affymetrix, Inc. Methods of Analysis of Methylation
EP1319718A1 (en) * 2001-12-14 2003-06-18 Keygene N.V. High throughput analysis and detection of multiple target sequences
CA2471198A1 (en) * 2001-12-20 2003-07-03 Merck & Co., Inc. Identification of novel polymorphic sites in the human mglur8 gene and uses thereof
US20060088826A1 (en) * 2001-12-28 2006-04-27 Van Eijk Michael Josephus Ther Discrimination and detection of target nucleotide sequences using mass spectrometry
ATE431407T1 (en) * 2002-01-11 2009-05-15 Biospring Ges Fuer Biotechnolo METHOD FOR PRODUCING DNA
DE10201463B4 (en) 2002-01-16 2005-07-21 Clondiag Chip Technologies Gmbh Reaction vessel for performing array method
US20050208491A1 (en) * 2002-02-08 2005-09-22 Rudolf Zirwes Specific multiplex analysis of nucleic acids
US7499806B2 (en) 2002-02-14 2009-03-03 Illumina, Inc. Image processing in microsphere arrays
US7282355B2 (en) * 2002-03-13 2007-10-16 Syngenta Participations Ag Nucleic acid detection method
US7081339B2 (en) * 2002-04-12 2006-07-25 Primera Biosystems, Inc. Methods for variation detection
DE10220935B3 (en) * 2002-05-10 2004-02-05 Siemens Ag Methods for the biochemical analysis of DNA and associated arrangement
EP1507873A4 (en) * 2002-05-24 2006-12-27 Cygene Inc Parallel stranded duplexes of deoxyribonucleic acid and methods of use
AU2003238796A1 (en) * 2002-05-28 2003-12-12 U.S. Genomics, Inc. Methods and apparati using single polymer analysis
DE60326839D1 (en) * 2002-06-12 2009-05-07 Genencor Int METHOD FOR IMPROVING A BONDING PROPERTY OF A MOLECULE
FI20021325A0 (en) * 2002-07-05 2002-07-05 Valtion Teknillinen Method and kit for determining the amount of individual polynucleotides
US7192700B2 (en) * 2002-12-20 2007-03-20 Orchid Cellmark Inc. Methods and compositions for conducting primer extension and polymorphism detection reactions
WO2004027384A2 (en) * 2002-09-17 2004-04-01 Perkinelmer Life Sciences, Inc. Real-time detection of nucleic acid reactions
US7153658B2 (en) * 2002-09-19 2006-12-26 Applera Corporation Methods and compositions for detecting targets
EP1540003A4 (en) * 2002-09-19 2006-06-21 Applera Corp Methods and composition for detecting targets
US20040259105A1 (en) * 2002-10-03 2004-12-23 Jian-Bing Fan Multiplex nucleic acid analysis using archived or fixed samples
GB0223563D0 (en) * 2002-10-10 2002-11-20 Secr Defence Detection system
US20040235005A1 (en) * 2002-10-23 2004-11-25 Ernest Friedlander Methods and composition for detecting targets
AU2002342093A1 (en) * 2002-10-23 2004-05-25 Applera Corporation Methods and composition for detecting targets
AU2003298655A1 (en) 2002-11-15 2004-06-15 Bioarray Solutions, Ltd. Analysis, secure access to, and transmission of array images
AU2003294417A1 (en) * 2002-11-19 2004-06-15 Applera Corporation Polynucleotide sequence detection assays and analysis
US20050053957A1 (en) * 2002-11-19 2005-03-10 Applera Corporation Polynucleotide sequence detection assays
GB2395557A (en) * 2002-11-22 2004-05-26 Dynal Biotech Ltd Nucleic acid probes
AU2003298706A1 (en) 2002-12-04 2004-06-23 Applera Corporation Multiplex amplification of polynucleotides
WO2004053105A2 (en) * 2002-12-12 2004-06-24 Nanosphere, Inc. Direct snp detection with unamplified dna
US8206904B2 (en) 2002-12-18 2012-06-26 Third Wave Technologies, Inc. Detection of nucleic acids
US7851150B2 (en) * 2002-12-18 2010-12-14 Third Wave Technologies, Inc. Detection of small nucleic acids
US7682565B2 (en) 2002-12-20 2010-03-23 Biotrove, Inc. Assay apparatus and method using microfluidic arrays
US9487823B2 (en) * 2002-12-20 2016-11-08 Qiagen Gmbh Nucleic acid amplification
AU2003299818A1 (en) 2002-12-20 2004-07-22 Applera Corporation Genetic polymorphisms associated with myocardial infarction, methods of detection and uses thereof
US20060094108A1 (en) * 2002-12-20 2006-05-04 Karl Yoder Thermal cycler for microfluidic array assays
US20040180369A1 (en) * 2003-01-16 2004-09-16 North Carolina State University Photothermal detection of nucleic acid hybridization
CA2513985C (en) 2003-01-21 2012-05-29 Illumina Inc. Chemical reaction monitor
US6943768B2 (en) 2003-02-21 2005-09-13 Xtellus Inc. Thermal control system for liquid crystal cell
US8043834B2 (en) * 2003-03-31 2011-10-25 Qiagen Gmbh Universal reagents for rolling circle amplification and methods of use
DE10315074A1 (en) 2003-04-02 2004-10-14 Clondiag Chip Technologies Gmbh Device for the duplication and detection of nucleic acids
JP2006523465A (en) 2003-04-14 2006-10-19 ニューゲン テクノロジーズ, インコーポレイテッド Large-scale amplification using randomly primed composite primers
WO2004094653A2 (en) * 2003-04-22 2004-11-04 Irm Llc Differential tag length analysis of cell proliferation
WO2004104172A2 (en) * 2003-05-15 2004-12-02 Bioarray Solutions, Ltd. Hybridization-mediated analysis of polymorphisms
DE10323685A1 (en) * 2003-05-22 2004-12-09 Rühe, Jürgen, Prof. Dr. Process for the covalent immobilization of probe biomolecules on organic surfaces
ATE358733T1 (en) * 2003-06-02 2007-04-15 Check Points Holding B V RAPID METHOD FOR DETECTING MICROORGANISMS IN FOOD SAMPLES
WO2005001129A2 (en) * 2003-06-06 2005-01-06 Applera Corporation Mobility cassettes
EP1641936B1 (en) 2003-06-17 2010-08-04 Human Genetic Signatures PTY Ltd. Methods for genome amplification
US20070111204A1 (en) * 2003-06-27 2007-05-17 Kathleen Delgrosso Methods for detecting nucleic acid variations
EP1647592B1 (en) * 2003-06-30 2009-03-11 Panasonic Corporation Method of modifying nucleotide chain
US20100291637A1 (en) * 2003-06-30 2010-11-18 Panasonic Corporation Method for modifying nucleotide chain
CN1580283A (en) * 2003-08-13 2005-02-16 清华大学 Method for detecting nucleic acid molecule
GB0319949D0 (en) * 2003-08-26 2003-09-24 Univ Strathclyde Nucleic acid sequence identification
US8808991B2 (en) 2003-09-02 2014-08-19 Keygene N.V. Ola-based methods for the detection of target nucleic avid sequences
CN1863927B (en) 2003-09-04 2010-08-11 人类遗传标记控股有限公司 Nucleic acid detection assay
US20050266417A1 (en) * 2003-09-12 2005-12-01 Francis Barany Methods for identifying target nucleic acid molecules
US7927796B2 (en) * 2003-09-18 2011-04-19 Bioarray Solutions, Ltd. Number coding for identification of subtypes of coded types of solid phase carriers
CN1882699A (en) 2003-09-22 2006-12-20 佰尔瑞溶液有限公司 Surface immobilized polyelectrolyte with multiple functional groups capable of covalently bonding to biomolecules
WO2005045059A2 (en) * 2003-10-28 2005-05-19 Bioarray Solutions Ltd. Allele assignment and probe selection in multiplexed assays of polymorphic targets
WO2005042763A2 (en) 2003-10-28 2005-05-12 Bioarray Solutions Ltd. Optimization of gene expression analysis using immobilized capture probes
CN1882703B (en) 2003-10-29 2011-07-06 佰尔瑞溶液有限公司 Multiplexed nucleic acid analysis by fragmentation of double-stranded DNA
US20050191651A1 (en) * 2003-10-30 2005-09-01 North Carolina State University Temperature-jump enhanced electrochemical detection of nucleic acid hybridization
WO2005042785A1 (en) * 2003-10-30 2005-05-12 North Carolina State University Electrochemical detection of nucleic acid hybridization
CA2921196C (en) 2003-11-26 2019-03-05 Celera Corporation Single nucleotide polymorphisms associated with cardiovascular disorders and statin response, methods of detection and uses thereof
US20050130213A1 (en) * 2003-12-10 2005-06-16 Tom Morrison Selective ligation and amplification assay
US7582430B2 (en) * 2004-01-20 2009-09-01 United States Of America As Represented By The Secretary Of The Army Immunoliposome-nucleic acid amplification (ILNAA) assay
DE102004003860A1 (en) 2004-01-26 2005-08-18 Clondiag Chip Technologies Gmbh Method for genotyping and pathotyping of Pseudomonas aeruginosa
EP1561823A1 (en) * 2004-02-04 2005-08-10 Biotez Berlin-Buch GmbH Method for the detection of single nucleotid polymorphisms (SNP) of genes of drug metabolism and test system for performing such a method
EP1718766A4 (en) * 2004-02-10 2009-05-27 Cornell Res Foundation Inc METHOD FOR DETECTING PROMOTER METHYLATION STATE
EP1715954A1 (en) 2004-02-18 2006-11-02 Applera Corporation Multi-step bioassays on modular microfluidic application platforms
US8304192B2 (en) * 2004-03-05 2012-11-06 University Of Toledo Methods and compositions for assessing nucleic acids and alleles
WO2005092038A2 (en) * 2004-03-22 2005-10-06 The Johns Hopkins University Methods for the detection of nucleic acid differences
ATE399884T1 (en) * 2004-03-24 2008-07-15 Applera Corp CODING AND DECODING REACTIONS FOR DETERMINING TARGET POLYNUCLEOTIDES
EP1745157A4 (en) * 2004-04-12 2008-06-11 Ohio Med College METHODS AND COMPOSITIONS FOR ANALYZING ANALYTES
US8168777B2 (en) 2004-04-29 2012-05-01 Human Genetic Signatures Pty. Ltd. Bisulphite reagent treatment of nucleic acid
US20050282195A1 (en) * 2004-04-30 2005-12-22 Applera Corporation Compositions, methods, and kits for (MIS)ligating oligonucleotides
US7364855B2 (en) * 2004-04-30 2008-04-29 Applera Corporation Methods and kits for methylation detection
DE102005052713A1 (en) 2005-11-04 2007-05-16 Clondiag Chip Tech Gmbh Apparatus and method for detecting molecular interactions
DE102004022263A1 (en) 2004-05-06 2005-12-15 Clondiag Chip Technologies Gmbh Apparatus and method for detecting molecular interactions
EP1745154B1 (en) 2004-05-07 2012-08-01 Celera Corporation Genetic polymorphisms associated with liver fibrosis methods of detection and uses thereof
US7622281B2 (en) * 2004-05-20 2009-11-24 The Board Of Trustees Of The Leland Stanford Junior University Methods and compositions for clonal amplification of nucleic acid
US7575863B2 (en) 2004-05-28 2009-08-18 Applied Biosystems, Llc Methods, compositions, and kits comprising linker probes for quantifying polynucleotides
WO2005118871A1 (en) * 2004-05-28 2005-12-15 The Arizona Board Of Regents Surface plasmon resonance sensor for detecting changes in polynucleotides mass
US7785843B2 (en) * 2004-06-23 2010-08-31 Sequenom, Inc. Target-specific compomers and methods of use
JP2008502352A (en) * 2004-06-30 2008-01-31 アプレラ コーポレイション Methods, reaction mixtures and kits for ligating polynucleotides
US7363170B2 (en) * 2004-07-09 2008-04-22 Bio Array Solutions Ltd. Transfusion registry network providing real-time interaction between users and providers of genetically characterized blood products
WO2006014869A1 (en) * 2004-07-26 2006-02-09 Parallele Bioscience, Inc. Simultaneous analysis of multiple genomes
DE102004037081A1 (en) * 2004-07-30 2006-03-23 Universität Bremen Hybridization assay of nucleic acid, useful particularly for identifying nitrogen-fixing microorganisms, where the complex formed includes a lable in, or close to, the hybrid region
DE112005001815A5 (en) * 2004-07-30 2007-06-14 Universität Bremen Method for analyzing samples by means of hybridization
US7848889B2 (en) 2004-08-02 2010-12-07 Bioarray Solutions, Ltd. Automated analysis of multiplexed probe-target interaction patterns: pattern matching and allele identification
EP1623996A1 (en) * 2004-08-06 2006-02-08 Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts Improved method of selecting a desired protein from a library
US20060040258A1 (en) * 2004-08-23 2006-02-23 Huiyan Guo Water-soluble conjugates and methods of preparation
DK1794173T3 (en) 2004-09-10 2010-10-25 Human Genetic Signatures Pty Amplification blocks containing intercalating nucleic acids (INA) containing intercalating pseudonucleotides (IPN)
ATE494392T1 (en) 2004-09-21 2011-01-15 Life Technologies Corp TWO-COLOR REAL-TIME/ENDPOINT QUANTIFICATION OF MICRO-RNAS (MIRNAS)
ES2301268B1 (en) * 2004-10-25 2009-05-01 Centro De Investigacion Biomolecular Aplicada Salamanca, S.L. USE OF GEN SLUG, OR ITS REPLICATION, TRANSCRIPTION OR EXPRESSION PRODUCTS, IN THE IDENTIFICATION, DIAGNOSIS, PREVENTION OR TREATMENT OF CANCER DISSEMINATION AND / OR METASTASIS DEVELOPMENT.
US20080004208A1 (en) * 2004-12-03 2008-01-03 Aichi Prefecture Methods for Diagnosis and Prognosis of Malignant Lymphoma
CA2589668C (en) 2004-12-03 2014-09-02 Human Genetic Signatures Pty Ltd Methods for simplifying microbial nucleic acids by chemical modification of cytosines
US20060134650A1 (en) * 2004-12-21 2006-06-22 Illumina, Inc. Methylation-sensitive restriction enzyme endonuclease method of whole genome methylation analysis
US7169561B2 (en) * 2004-12-29 2007-01-30 Applera Corporation Methods, compositions, and kits for forming self-complementary polynucleotides
US20060211024A1 (en) * 2005-03-10 2006-09-21 Gwc Technologies Incorporated Methods for analysis of a nucleic acid sample
EP1856296A2 (en) 2005-03-11 2007-11-21 Applera Corporation Genetic polymorphisms associated with coronary heart disease, methods of detection and uses thereof
US20060205090A1 (en) * 2005-03-14 2006-09-14 Newton Michael W Water-soluble conjugates for electrochemical detection
US20070026423A1 (en) * 2005-03-16 2007-02-01 Thomas Koehler Method and test kit for the detection of target nucleic acids
EP1863908B1 (en) * 2005-04-01 2010-11-17 Qiagen GmbH Reverse transcription and amplification of rna with simultaneous degradation of dna
US20060240442A1 (en) * 2005-04-20 2006-10-26 Vevea Dirk N Methods and oligonucleotides for the detection of Salmonella SP., E coli 0157:H7, and Listeria monocytogenes
US20060246463A1 (en) * 2005-04-20 2006-11-02 Vevea Dirk N Methods and oligonucleotides for the detection of Salmonella SP., E coli 0157:H7, and Listeria monocytogenes
US20070009925A1 (en) * 2005-05-05 2007-01-11 Applera Corporation Genomic dna sequencing methods and kits
JP2008541705A (en) 2005-05-26 2008-11-27 ヒューマン ジェネティック シグネチャーズ ピーティーワイ リミテッド Isothermal strand displacement amplification using primers containing non-standard bases
JP4879975B2 (en) * 2005-05-31 2012-02-22 アプライド バイオシステムズ リミテッド ライアビリティー カンパニー Multiplex amplification of short nucleic acids
US8486629B2 (en) 2005-06-01 2013-07-16 Bioarray Solutions, Ltd. Creation of functionalized microparticle libraries by oligonucleotide ligation or elongation
US20060276220A1 (en) * 2005-06-03 2006-12-07 Judith Schure Cell phone case with magnifier and method
US20070065844A1 (en) * 2005-06-08 2007-03-22 Massachusetts Institute Of Technology Solution-based methods for RNA expression profiling
US20070087360A1 (en) * 2005-06-20 2007-04-19 Boyd Victoria L Methods and compositions for detecting nucleotides
EP1913159B1 (en) * 2005-06-30 2010-12-01 GE Healthcare Bio-Sciences Corp. Detection method for gene expression
US7977108B2 (en) * 2005-07-25 2011-07-12 Roche Molecular Systems, Inc. Method for detecting a mutation in a repetitive nucleic acid sequence
US20070065847A1 (en) * 2005-08-11 2007-03-22 Affymetrix, Inc. Degeneratively Labeled Probes
ATE532878T1 (en) 2005-08-24 2011-11-15 Life Technologies Corp METHOD FOR QUANTIFYING SIRNAS, MIRNAS AND POLYMORPHOIC MIRNAS
US7939258B2 (en) * 2005-09-07 2011-05-10 Nugen Technologies, Inc. Nucleic acid amplification procedure using RNA and DNA composite primers
EP1762627A1 (en) 2005-09-09 2007-03-14 Qiagen GmbH Method for the activation of a nucleic acid for performing a polymerase reaction
DE602005005333T2 (en) * 2005-09-13 2008-09-18 Eppendorf Array Technologies S.A. Method for detecting homologous sequences differing by a base on a microarray
WO2007030882A1 (en) 2005-09-14 2007-03-22 Human Genetic Signatures Pty Ltd Assay for a health state
US7799530B2 (en) 2005-09-23 2010-09-21 Celera Corporation Genetic polymorphisms associated with cardiovascular disorders and drug response, methods of detection and uses thereof
US20070141604A1 (en) * 2005-11-15 2007-06-21 Gormley Niall A Method of target enrichment
WO2007065025A2 (en) * 2005-11-29 2007-06-07 Wisconsin Alumni Research Foundation Method of dna analysis using micro/nanochannel
US7932037B2 (en) * 2007-12-05 2011-04-26 Perkinelmer Health Sciences, Inc. DNA assays using amplicon probes on encoded particles
US20100009373A1 (en) * 2005-12-23 2010-01-14 Perkinelmer Health Sciences, Inc. Methods and compositions relating to multiplex genomic gain and loss assays
CN101384732B (en) * 2005-12-23 2015-11-25 珀金埃尔默Las公司 The comparative genome hybridization of the multiplex particles of coding
US20090104613A1 (en) * 2005-12-23 2009-04-23 Perkinelmer Las, Inc. Methods and compositions relating to multiplexed genomic gain and loss assays
JP5537034B2 (en) 2005-12-23 2014-07-02 ナノストリング テクノロジーズ,インコーポレーテッド Nanoreporter and method for producing and using the same
US20100137163A1 (en) 2006-01-11 2010-06-03 Link Darren R Microfluidic Devices and Methods of Use in The Formation and Control of Nanoreactors
JP4989493B2 (en) * 2006-01-20 2012-08-01 オリンパス株式会社 Method for detecting nucleic acid sequence by intramolecular probe
ATE541057T1 (en) 2006-02-13 2012-01-15 Us Gov Health & Human Serv PRIMERS AND PROBE FOR DETECTION AND DISTINCTION OF TYPES AND SUBTYPES OF INFLUENZA VIRUS
US20070196832A1 (en) * 2006-02-22 2007-08-23 Efcavitch J William Methods for mutation detection
WO2007101075A2 (en) * 2006-02-22 2007-09-07 Applera Corporation Double-ligation method for haplotype and large-scale polymorphism detection
ES2446927T3 (en) * 2006-03-01 2014-03-10 Keygene N.V. Rapid sequence-based SNP detection using ligation assays
US8673567B2 (en) * 2006-03-08 2014-03-18 Atila Biosystems, Inc. Method and kit for nucleic acid sequence detection
US10522240B2 (en) 2006-05-03 2019-12-31 Population Bio, Inc. Evaluating genetic disorders
US7702468B2 (en) 2006-05-03 2010-04-20 Population Diagnostics, Inc. Evaluating genetic disorders
DE102006020885A1 (en) * 2006-05-05 2007-11-08 Qiagen Gmbh Inserting a tag sequence into a nucleic acid comprises using an anchor oligonucleotide comprising a hybridizing anchor sequence and a nonhybridizing tag-template sequence
WO2007133710A2 (en) 2006-05-11 2007-11-22 Raindance Technologies, Inc. Microfluidic devices and methods of use thereof
US9074242B2 (en) 2010-02-12 2015-07-07 Raindance Technologies, Inc. Digital analyte analysis
US9562837B2 (en) 2006-05-11 2017-02-07 Raindance Technologies, Inc. Systems for handling microfludic droplets
US7833716B2 (en) 2006-06-06 2010-11-16 Gen-Probe Incorporated Tagged oligonucleotides and their use in nucleic acid amplification methods
US20090286694A1 (en) * 2006-08-21 2009-11-19 Gafur Zainiev Nucleic acid array with releaseable nucleic acid probes
US20080044822A1 (en) * 2006-08-21 2008-02-21 Gafur Zainiev Nucleic acid array with releaseable nucleic acid probes
US20100056388A1 (en) * 2006-08-21 2010-03-04 Cnvgenes, Inc. Nucleic acid array having fixed nucleic acid anti-probes and complementary free nucleic acid probes
US20080044821A1 (en) * 2006-08-21 2008-02-21 Gafur Zainiev Nucleic acid array having fixed nucleic acid anti-probes and complementary free nucleic acid probes
US20080050724A1 (en) * 2006-08-24 2008-02-28 Microfluidic Systems, Inc. Method of detecting one or more limited copy targets
JP2008072950A (en) * 2006-09-21 2008-04-03 Sysmex Corp Method for confirming conversion treatment and nucleic acid molecule used therefor
EP2076609A1 (en) 2006-10-10 2009-07-08 Illumina Inc. Compositions and methods for representational selection of nucleic acids fro complex mixtures using hybridization
US20080090238A1 (en) * 2006-10-12 2008-04-17 Dan-Hui Dorothy Yang Increased sensitivity of proximity ligation assays
US7910303B2 (en) 2006-10-20 2011-03-22 Celera Corporation Genetic polymorphisms associated with venous thrombosis, methods of detection and uses thereof
US20090074637A1 (en) * 2006-11-03 2009-03-19 Murphy Michael C Optimized Modular Microfluidic Devices
US8133701B2 (en) * 2006-12-05 2012-03-13 Sequenom, Inc. Detection and quantification of biomolecules using mass spectrometry
US7902345B2 (en) * 2006-12-05 2011-03-08 Sequenom, Inc. Detection and quantification of biomolecules using mass spectrometry
JP2008148570A (en) * 2006-12-14 2008-07-03 Hitachi Ltd Microorganism detection system
EP3121286B1 (en) 2006-12-21 2019-11-20 Gen-Probe Incorporated Methods and compositions for nucleic acid amplification
CA3045637A1 (en) 2006-12-27 2008-07-10 Emory University Compositions and methods for the treatment of infections and tumors
WO2008085857A2 (en) 2007-01-04 2008-07-17 Children's Hospital Medical Center Processing text with domain-specific spreading activation methods
US20080182235A1 (en) * 2007-01-30 2008-07-31 Celsis International Plc Detection of Analytes in Samples Using Liposome-Amplified Luminescence and Magnetic Separation
WO2008097559A2 (en) 2007-02-06 2008-08-14 Brandeis University Manipulation of fluids and reactions in microfluidic systems
US8865400B2 (en) 2007-02-07 2014-10-21 Decode Genetics Ehf. Genetic variants contributing to risk of prostate cancer
US8906620B2 (en) 2007-03-23 2014-12-09 Dana-Farber Cancer Institute, Inc. Exon grouping analysis
WO2008118998A2 (en) * 2007-03-27 2008-10-02 Primera Biosystems Inc. Method for multiplex detection and quantitation of nucleic acids
WO2008130623A1 (en) 2007-04-19 2008-10-30 Brandeis University Manipulation of fluids, fluid components and reactions in microfluidic systems
US20080274458A1 (en) * 2007-05-01 2008-11-06 Latham Gary J Nucleic acid quantitation methods
EP2158335A2 (en) 2007-05-21 2010-03-03 Genetech, Inc. Methods and compositions for identifying and treating lupus
US20090036325A1 (en) * 2007-05-25 2009-02-05 Applera Corporation Directed assembly of amplicons to enhance read pairing signature with massively parallel short read sequencers
EA018444B1 (en) * 2007-05-25 2013-08-30 Декоуд Дженетикс Ехф. GENETIC VARIANTS ON Chr 5p12 AND 10q26 AS MARKERS FOR USE IN BREAST CANCER RISK ASSESSMENT, DIAGNOSIS, PROGNOSIS AND TREATMENT
US7947446B2 (en) * 2007-05-29 2011-05-24 Ming-Sheng Lee High throughput mutation screening methods and kits using a universalized approach—differential sequence fill-in (DSF)-enabled sequential adapter ligation and amplification
WO2008151004A1 (en) 2007-05-31 2008-12-11 Yale University A genetic lesion associated with cancer
JP5730568B2 (en) * 2007-06-01 2015-06-10 モノクアント・ピーティーワイ・リミテッド Method for analysis of DNA breakpoints
CA2690043A1 (en) * 2007-06-06 2008-12-18 Bio-Rad Laboratories, Inc. Signal amplification using circular hairpin probes
JP5165933B2 (en) * 2007-06-12 2013-03-21 日本碍子株式会社 Method and array for detecting specific partial sequence in target nucleic acid
US8008010B1 (en) * 2007-06-27 2011-08-30 Applied Biosystems, Llc Chimeric oligonucleotides for ligation-enhanced nucleic acid detection, methods and compositions therefor
US9512470B2 (en) * 2007-07-11 2016-12-06 Pathofinder Holding B.V. Method for the simultaneous detection of multiple nucleic acid sequences in a sample
EP2195452B1 (en) 2007-08-29 2012-03-14 Sequenom, Inc. Methods and compositions for universal size-specific polymerase chain reaction
CA2697640C (en) * 2007-09-21 2016-06-21 Katholieke Universiteit Leuven Tools and methods for genetic tests using next generation sequencing
WO2009046445A1 (en) * 2007-10-04 2009-04-09 Halcyon Molecular Sequencing nucleic acid polymers with electron microscopy
CA2702169A1 (en) * 2007-10-12 2009-04-16 Decode Genetics Ehf Sequence variants for inferring human pigmentation patterns
US9428746B2 (en) 2007-10-31 2016-08-30 Akonni Biosystems, Inc. Method and kit for purifying nucleic acids
US7759112B2 (en) * 2007-10-31 2010-07-20 Akonni Biosystems, Inc. Apparatus, system, and method for purifying nucleic acids
US10125388B2 (en) 2007-10-31 2018-11-13 Akonni Biosystems, Inc. Integrated sample processing system
US20090111193A1 (en) 2007-10-31 2009-04-30 Cooney Christopher G Sample preparation device
US8039212B2 (en) 2007-11-05 2011-10-18 Celera Corporation Genetic polymorphisms associated with liver fibrosis, methods of detection and uses thereof
CA2706740C (en) 2007-11-27 2017-01-17 Human Genetic Signatures Pty Ltd Enzymes for amplification and copying bisulphite modified nucleic acids
US8093063B2 (en) * 2007-11-29 2012-01-10 Quest Diagnostics Investments Incorporated Assay for detecting genetic abnormalities in genomic nucleic acids
WO2009073629A2 (en) 2007-11-29 2009-06-11 Complete Genomics, Inc. Efficient shotgun sequencing methods
US8697360B2 (en) 2007-11-30 2014-04-15 Decode Genetics Ehf. Genetic variants on CHR 11Q and 6Q as markers for prostate and colorectal cancer predisposition
US20090181390A1 (en) * 2008-01-11 2009-07-16 Signosis, Inc. A California Corporation High throughput detection of micrornas and use for disease diagnosis
JP5685085B2 (en) 2008-01-14 2015-03-18 アプライド バイオシステムズ リミテッド ライアビリティー カンパニー Composition, method and kit for detecting ribonucleic acid
US20090203531A1 (en) * 2008-02-12 2009-08-13 Nurith Kurn Method for Archiving and Clonal Expansion
NZ587903A (en) * 2008-02-14 2013-05-31 Decode Genetics Ehf Susceptibility for lung cancer using the polymorphic marker rs1051730
US20090221620A1 (en) 2008-02-20 2009-09-03 Celera Corporation Gentic polymorphisms associated with stroke, methods of detection and uses thereof
MX2010010161A (en) * 2008-03-15 2011-03-21 Hologic Inc Star Compositions and methods for analysis of nucleic acid molecules during amplification reactions.
US7846666B2 (en) 2008-03-21 2010-12-07 Nugen Technologies, Inc. Methods of RNA amplification in the presence of DNA
JP5319148B2 (en) * 2008-03-27 2013-10-16 日本碍子株式会社 Method and array for detecting mutations in target nucleic acid
US8808985B2 (en) 2008-04-01 2014-08-19 Decode Genetics Ehf. Susceptibility variants for peripheral arterial disease and abdominal aortic aneurysm
PT2271767T (en) * 2008-04-03 2016-08-18 Cb Biotechnologies Inc Amplicon rescue multiplex polymerase chain reaction for amplificaton of multiple targets
EP2281198B1 (en) * 2008-04-19 2013-01-02 New York University Immunodominant mycobacterium tuberculosis peptides from cell wall proteins for early diagnosis and immunization
JP2009268665A (en) * 2008-05-07 2009-11-19 Canon Inc Inhalation device
US20110160080A1 (en) 2008-05-14 2011-06-30 Chang Sherman H Diagnosis of Melanoma and Solar Lentigo by Nucleic Acid Analysis
CN101586150B (en) * 2008-05-23 2016-09-28 陕西佰美基因股份有限公司 Detection probe, general oligonucleotide chip and nucleic acid detection method and application thereof
US20110111419A1 (en) * 2008-07-04 2011-05-12 deCODE Geneties ehf. Copy Number Variations Predictive of Risk of Schizophrenia
JP2011527565A (en) 2008-07-07 2011-11-04 ディコーデ ジェネテクス イーエイチエフ Genetic variation for breast cancer risk assessment
EP3093351B1 (en) 2008-07-09 2018-04-18 Celera Corporation Genetic polymorphisms associated with cardiovascular diseases, methods of detection and uses thereof
EP2315629B1 (en) 2008-07-18 2021-12-15 Bio-Rad Laboratories, Inc. Droplet libraries
US12038438B2 (en) 2008-07-18 2024-07-16 Bio-Rad Laboratories, Inc. Enzyme quantification
US20100159506A1 (en) * 2008-07-25 2010-06-24 Cellscape Corporation Methods and systems for genetic analysis of fetal nucleated red blood cells
EP2333059A4 (en) * 2008-07-30 2013-01-09 Nippon Steel Kankyo Engineering Co Ltd UNIVERSAL SET OF NUCLEIC ACID PROBES AND METHOD FOR THEIR USE
CN102177252B (en) * 2008-08-12 2014-12-24 解码遗传学私营有限责任公司 Genetic variants useful for risk assessment of thyroid cancer
EP2329037B1 (en) * 2008-08-15 2015-01-28 Decode Genetics EHF Genetic variants predictive of cancer risk
WO2010027870A2 (en) * 2008-08-26 2010-03-11 Fluidigm Corporation Assay methods for increased throughput of samples and/or targets
ES2716807T3 (en) 2008-11-07 2019-06-17 Univ Utah Res Found Allele amplification bias
DK2370593T3 (en) 2008-11-28 2016-07-04 Univ Emory A method for determining the effect of PD-1 Antagonists
JP2012511927A (en) 2008-12-17 2012-05-31 ライフ テクノロジーズ コーポレーション Methods, compositions, and kits for detecting allelic variants
SI2384368T1 (en) 2009-01-30 2016-04-29 Kantonsspital Aarau Ag Gene dosage analysis
CA2751287A1 (en) 2009-02-06 2010-09-10 Yale University A snp marker of breast and ovarian cancer risk
EP2399131B1 (en) 2009-02-20 2014-08-27 The U.S.A. As Represented By The Secretary, Department Of Health And Human Services Method for the diagnosis of age-associated vascular disorders
EP3249053A1 (en) 2009-03-27 2017-11-29 Life Technologies Corporation Methods, compositions, and kits for detecting allelic variants
US20120021949A1 (en) * 2009-03-31 2012-01-26 Centre Hospitalier Universitaire Vaudois Methylation Ligation-Dependent Macroarray (MLM)
DK2414544T3 (en) * 2009-04-01 2014-06-16 Dxterity Diagnostics Inc Probe amplification-dependent chemical ligation
CA2757560C (en) 2009-04-02 2018-11-13 Fluidigm Corporation Multi-primer amplification method for barcoding of target nucleic acids
AU2010231494B2 (en) 2009-04-03 2016-01-07 Decode Genetics Ehf Genetic markers for risk management of atrial fibrillation and stroke
EP2256215A1 (en) 2009-04-30 2010-12-01 Steffen Mergemeier Assay system using a nuclease activity of a nucleic acid polymerase
WO2010128530A1 (en) * 2009-05-08 2010-11-11 Decode Genetics Ehf Genetic variants contributing to risk of prostate cancer
US20110003301A1 (en) * 2009-05-08 2011-01-06 Life Technologies Corporation Methods for detecting genetic variations in dna samples
US20100299773A1 (en) * 2009-05-20 2010-11-25 Monsanto Technology Llc Methods and compositions for selecting an improved plant
CA2763321C (en) 2009-05-29 2018-10-16 Ventana Medical Systems, Inc. Methods of scoring gene copy number in a biological sample using in situ hybridization
WO2010138908A1 (en) 2009-05-29 2010-12-02 Ventana Medical Systems, Inc. Igfir gene copy number as a prognostic marker in a non-small cell lung cancer
WO2010138926A1 (en) 2009-05-29 2010-12-02 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services, Centers For Disease Control And Prevention Nucleic acids for detection and discrimination of genotypes of chlamydophila psittaci
CA2766210A1 (en) 2009-06-25 2010-12-29 Yale University Single nucleotide polymorphisms in brca1 and cancer risk
EP2449132B1 (en) 2009-07-01 2015-05-13 Gen-Probe Incorporated Methods and compositions for nucleic acid amplification
AU2010269841A1 (en) 2009-07-10 2012-02-23 Decode Genetics Ehf Genetic markers associated with risk of diabetes mellitus
US9487839B2 (en) * 2009-09-29 2016-11-08 Case Western Reserve University Method for detecting single nucleotide polymorphisms
CN113025703A (en) 2009-10-07 2021-06-25 弗·哈夫曼-拉罗切有限公司 Methods for treating, diagnosing and monitoring lupus
CN102639714A (en) * 2009-10-29 2012-08-15 日本碍子株式会社 Method for detection of target nucleic acid
EP2510126B1 (en) * 2009-12-07 2017-08-09 Illumina, Inc. Multi-sample indexing for multiplex genotyping
US8835358B2 (en) 2009-12-15 2014-09-16 Cellular Research, Inc. Digital counting of individual molecules by stochastic attachment of diverse labels
US9499814B2 (en) 2010-01-22 2016-11-22 The Regents Of The University Of California Methods for identifying drug effects on a cell by determining changes in the cell's spliced message profile
US9399797B2 (en) 2010-02-12 2016-07-26 Raindance Technologies, Inc. Digital analyte analysis
US8774488B2 (en) 2010-03-11 2014-07-08 Cellscape Corporation Method and device for identification of nucleated red blood cells from a maternal blood sample
AU2011237729B2 (en) 2010-04-05 2014-04-03 Prognosys Biosciences, Inc. Spatially encoded biological assays
US20190300945A1 (en) 2010-04-05 2019-10-03 Prognosys Biosciences, Inc. Spatially Encoded Biological Assays
US10787701B2 (en) 2010-04-05 2020-09-29 Prognosys Biosciences, Inc. Spatially encoded biological assays
AU2011243039B2 (en) 2010-04-16 2015-01-15 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services, Centers For Disease Control And Prevention Real time PCR assay for detection of bacterial respiratory pathogens
US9828637B2 (en) 2010-04-18 2017-11-28 Wake Forest University Health Sciences Methods of predicting predisposition to or risk of kidney disease
US20110269735A1 (en) 2010-04-19 2011-11-03 Celera Corporation Genetic polymorphisms associated with statin response and cardiovascular diseases, methods of detection and uses thereof
WO2012006056A2 (en) 2010-06-29 2012-01-12 Oregon Health & Science University Ccr6 as a biomarker of alzheimer's disease
WO2012003330A2 (en) 2010-06-30 2012-01-05 Stratos Genomics, Inc Multiplexed identification of nucleic acid sequences
SMT201800213T1 (en) * 2010-07-09 2018-07-17 Cergentis B V V3-d genomic region of interest sequencing strategies
EP2601609B1 (en) 2010-08-02 2017-05-17 Population Bio, Inc. Compositions and methods for discovery of causative mutations in genetic disorders
US8700338B2 (en) 2011-01-25 2014-04-15 Ariosa Diagnosis, Inc. Risk calculation for evaluation of fetal aneuploidy
US10167508B2 (en) 2010-08-06 2019-01-01 Ariosa Diagnostics, Inc. Detection of genetic abnormalities
US20130040375A1 (en) 2011-08-08 2013-02-14 Tandem Diagnotics, Inc. Assay systems for genetic analysis
US20130261003A1 (en) 2010-08-06 2013-10-03 Ariosa Diagnostics, In. Ligation-based detection of genetic variants
US10533223B2 (en) 2010-08-06 2020-01-14 Ariosa Diagnostics, Inc. Detection of target nucleic acids using hybridization
US11031095B2 (en) 2010-08-06 2021-06-08 Ariosa Diagnostics, Inc. Assay systems for determination of fetal copy number variation
US20140342940A1 (en) 2011-01-25 2014-11-20 Ariosa Diagnostics, Inc. Detection of Target Nucleic Acids using Hybridization
US11203786B2 (en) 2010-08-06 2021-12-21 Ariosa Diagnostics, Inc. Detection of target nucleic acids using hybridization
US20120034603A1 (en) 2010-08-06 2012-02-09 Tandem Diagnostics, Inc. Ligation-based detection of genetic variants
MX345696B (en) 2010-08-30 2017-02-10 Dow Agrosciences Llc Sugarcane bacilliform viral (scbv) enhancer and its use in plant functional genomics.
CN103221543B (en) 2010-08-30 2016-10-05 陶氏益农公司 Colony and plant for the activation labeling platform of corn and the tape label of gained
WO2012034013A2 (en) 2010-09-10 2012-03-15 Bio-Rad Laboratories, Inc. Detection of rna-interacting regions in dna
WO2012054933A2 (en) * 2010-10-22 2012-04-26 Fluidigm Corporation Universal probe assay methods
US20120108651A1 (en) 2010-11-02 2012-05-03 Leiden University Medical Center (LUMC) Acting on Behalf of Academic Hospital Leiden (AZL) Genetic polymorphisms associated with venous thrombosis and statin response, methods of detection and uses thereof
WO2012076349A1 (en) * 2010-12-08 2012-06-14 Imec Heat-transfer resistance based analysis bioparticles
EP2663656B1 (en) 2011-01-13 2016-08-24 Decode Genetics EHF Genetic variants as markers for use in urinary bladder cancer risk assessment
DK2665833T3 (en) 2011-01-17 2017-07-24 Life Technologies Corp WORKING PROCEDURE FOR DETECTING LIGANDS USING NUCLEIC ACIDS
US9994897B2 (en) 2013-03-08 2018-06-12 Ariosa Diagnostics, Inc. Non-invasive fetal sex determination
US8756020B2 (en) 2011-01-25 2014-06-17 Ariosa Diagnostics, Inc. Enhanced risk probabilities using biomolecule estimations
EA201391074A1 (en) 2011-01-25 2013-12-30 Олмак Дайэгностикс Лимитед PROFILES OF EXPRESSION OF GENES OF CANCER OF THICK INTEST. AND METHODS OF APPLICATION
US20120190021A1 (en) 2011-01-25 2012-07-26 Aria Diagnostics, Inc. Detection of genetic abnormalities
US11270781B2 (en) 2011-01-25 2022-03-08 Ariosa Diagnostics, Inc. Statistical analysis for non-invasive sex chromosome aneuploidy determination
US10131947B2 (en) 2011-01-25 2018-11-20 Ariosa Diagnostics, Inc. Noninvasive detection of fetal aneuploidy in egg donor pregnancies
WO2012112606A1 (en) 2011-02-15 2012-08-23 Bio-Rad Laboratories, Inc. Detecting methylati0n in a subpopulation of genomic dna
WO2012112804A1 (en) 2011-02-18 2012-08-23 Raindance Technoligies, Inc. Compositions and methods for molecular labeling
WO2012112883A1 (en) 2011-02-18 2012-08-23 Yale University The kras-variant and endometriosis
US20120219950A1 (en) 2011-02-28 2012-08-30 Arnold Oliphant Assay systems for detection of aneuploidy and sex determination
AU2012203968A1 (en) 2011-03-21 2012-10-11 Yale University The KRAS variant and tumor biology
US8759036B2 (en) 2011-03-21 2014-06-24 Affymetrix, Inc. Methods for synthesizing pools of probes
KR102016182B1 (en) 2011-04-01 2019-08-29 제넨테크, 인크. Biomarkers for predicting sensitivity to cancer treatments
GB201106254D0 (en) 2011-04-13 2011-05-25 Frisen Jonas Method and product
US10172305B2 (en) 2011-04-29 2019-01-08 Monsanto Technology Llc Diagnostic molecular markers for seed lot purity traits in soybeans
BR112013028306B1 (en) 2011-05-02 2020-04-07 Univ Nebraska plants with useful characteristics and related processes
CA2834976C (en) 2011-05-04 2016-03-15 Htg Molecular Diagnostics, Inc. Quantitative nuclease protection assay (qnpa) and sequencing (qnps) improvements
US8809238B2 (en) 2011-05-09 2014-08-19 Fluidigm Corporation Probe based nucleic acid detection
EP2710145B1 (en) * 2011-05-17 2015-12-09 Dxterity Diagnostics Incorporated Methods and compositions for detecting target nucleic acids
SG194745A1 (en) 2011-05-20 2013-12-30 Fluidigm Corp Nucleic acid encoding reactions
EP3709018A1 (en) 2011-06-02 2020-09-16 Bio-Rad Laboratories, Inc. Microfluidic apparatus for identifying components of a chemical reaction
US9567628B2 (en) 2011-06-08 2017-02-14 Life Technologies Corporation Polymerization of nucleic acids using proteins having low isoelectric points
FI3461807T3 (en) 2011-06-08 2023-09-07 Life Technologies Corp Design and development of novel detergents for use in pcr systems
EP2729583B1 (en) 2011-07-05 2019-05-22 The Govt. Of The U.S.A. As Represented By The Secretary Of The Department Of Health & Human Services Hiv-1 genotyping assay for global surveillance of hiv-1 drug resistance
DK2729580T3 (en) 2011-07-08 2015-12-14 Keygene Nv SEQUENCE BASED genotyping BASED ON OLIGONUKLEOTIDLIGERINGSASSAYS
WO2013010074A1 (en) 2011-07-13 2013-01-17 Primeradx, Inc. Multimodal methods for simultaneous detection and quantification of multiple nucleic acids in a sample
US8658430B2 (en) 2011-07-20 2014-02-25 Raindance Technologies, Inc. Manipulating droplet size
WO2013012440A2 (en) * 2011-07-21 2013-01-24 Cornell University Methods and devices for dna sequencing and molecular diagnostics
WO2013033611A1 (en) 2011-08-31 2013-03-07 Monsanto Technology Llc Methods and compositions for watermelon firmness
MX350658B (en) 2011-09-07 2017-09-13 Human Genetic Signatures Pty Ltd Molecular detection assay.
US8712697B2 (en) 2011-09-07 2014-04-29 Ariosa Diagnostics, Inc. Determination of copy number variations using binomial probability calculations
KR20140066782A (en) * 2011-09-29 2014-06-02 루미넥스 코포레이션 Hydrolysis probes
WO2013049535A2 (en) 2011-09-30 2013-04-04 The United States Of America, As Represented By The Secretary, Department Of Health & Human Services Influenza vaccine
CA2851388C (en) 2011-10-10 2023-11-21 The Hospital For Sick Children Methods and compositions for screening and treating developmental disorders
EP2769007B1 (en) 2011-10-19 2016-12-07 Nugen Technologies, Inc. Compositions and methods for directional nucleic acid amplification and sequencing
DK2773779T3 (en) 2011-11-04 2020-11-23 Population Bio Inc METHODS AND COMPOSITIONS FOR DIAGNOSIS, FORECAST AND PREVENTION OF NEUROLOGICAL CONDITIONS
MX2014005683A (en) 2011-11-10 2015-01-22 Genentech Inc Methods for treating, diagnosing and monitoring alzheimer's disease.
WO2013071954A1 (en) 2011-11-15 2013-05-23 Université Libre de Bruxelles Streptococcus pneumoniae detection in blood
JP2015500638A (en) 2011-11-30 2015-01-08 ジェネンテック, インコーポレイテッド ERBB3 mutations in cancer
EP3483288B1 (en) 2011-11-30 2022-03-16 Children's Hospital Medical Center Personalized pain management and anesthesia: preemptive risk identification
KR20140145575A (en) 2011-12-14 2014-12-23 드 슈타트 데르 네덜란덴, 베르테겐부어디그트 두어 드 미니스터 반 베이웨이에스, 미니스테리 반 폭스겐트존하이트, 벨지인 엔 스포츠 Identification of poliovirus strains
WO2013106807A1 (en) 2012-01-13 2013-07-18 Curry John D Scalable characterization of nucleic acids by parallel sequencing
GB2533882B (en) 2012-01-26 2016-10-12 Nugen Tech Inc Method of enriching and sequencing nucleic acids of interest using massively parallel sequencing
US10407724B2 (en) 2012-02-09 2019-09-10 The Hospital For Sick Children Methods and compositions for screening and treating developmental disorders
EP3495817B1 (en) * 2012-02-10 2024-10-16 Bio-Rad Laboratories, Inc. Molecular diagnostic screening assay
US20150045258A1 (en) * 2012-02-14 2015-02-12 Gnubio, Inc. Cascaded addition of target specific universal adapters to nucleic acids
US11177020B2 (en) 2012-02-27 2021-11-16 The University Of North Carolina At Chapel Hill Methods and uses for molecular tags
CN104136611B (en) * 2012-02-27 2018-03-27 东丽株式会社 The detection method of nucleic acid
EP3321378B1 (en) 2012-02-27 2021-11-10 Becton, Dickinson and Company Compositions for molecular counting
EP3287531B1 (en) * 2012-02-28 2019-06-19 Agilent Technologies, Inc. Method for attaching a counter sequence to a nucleic acid sample
US9045803B2 (en) 2012-02-29 2015-06-02 Abbott Molecular Inc. Hepatitis B virus typing and resistance assay
AR090204A1 (en) 2012-02-29 2014-10-29 Dow Agrosciences Llc BACILIFORM VIRAL BOX OF SUGAR CANE (SCBV) AND ITS USE IN THE FUNCTIONAL GENOMICS OF PLANTS
WO2013148147A1 (en) 2012-03-26 2013-10-03 The U.S.A., As Represented By The Secretary Dept. Of Health And Human Services Dna methylation analysis for the diagnosis, prognosis and treatment of adrenal neoplasms
WO2013165551A1 (en) 2012-05-03 2013-11-07 The Government Of The Usa As Represented By The Secretary Of The Department Of Health And Human Services Methods of detecting influenza virus
KR101184566B1 (en) * 2012-05-11 2012-09-20 케이맥(주) Method for integrated analysis of real-time pcr and dna chip
CA2874343C (en) 2012-05-21 2021-11-09 Fluidigm Corporation Single-particle analysis of particle populations
US10289800B2 (en) 2012-05-21 2019-05-14 Ariosa Diagnostics, Inc. Processes for calculating phased fetal genomic sequences
MX2014014356A (en) 2012-05-24 2015-07-06 Fundació Inst D Investigació Biomédica De Bellvitge Idibell Method for the identification of the origin of a cancer of unknown primary origin by methylation analysis.
US9394574B2 (en) 2012-06-12 2016-07-19 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Methods for detecting Legionella nucleic acids in a sample
CN110343673B (en) 2012-06-14 2024-04-05 生命技术公司 Novel compositions, methods and kits for Polymerase Chain Reaction (PCR)
WO2013191775A2 (en) 2012-06-18 2013-12-27 Nugen Technologies, Inc. Compositions and methods for negative selection of non-desired nucleic acid sequences
WO2013192292A1 (en) 2012-06-21 2013-12-27 Justin Lamb Massively-parallel multiplex locus-specific nucleic acid sequence analysis
US20150011396A1 (en) 2012-07-09 2015-01-08 Benjamin G. Schroeder Methods for creating directional bisulfite-converted nucleic acid libraries for next generation sequencing
US9206417B2 (en) 2012-07-19 2015-12-08 Ariosa Diagnostics, Inc. Multiplexed sequential ligation-based detection of genetic variants
US9701998B2 (en) 2012-12-14 2017-07-11 10X Genomics, Inc. Methods and systems for processing polynucleotides
US11591637B2 (en) 2012-08-14 2023-02-28 10X Genomics, Inc. Compositions and methods for sample processing
CN104769127A (en) 2012-08-14 2015-07-08 10X基因组学有限公司 Microcapsule compositions and methods
US10752949B2 (en) 2012-08-14 2020-08-25 10X Genomics, Inc. Methods and systems for processing polynucleotides
US10323279B2 (en) 2012-08-14 2019-06-18 10X Genomics, Inc. Methods and systems for processing polynucleotides
US10273541B2 (en) 2012-08-14 2019-04-30 10X Genomics, Inc. Methods and systems for processing polynucleotides
US10400280B2 (en) 2012-08-14 2019-09-03 10X Genomics, Inc. Methods and systems for processing polynucleotides
US9951386B2 (en) 2014-06-26 2018-04-24 10X Genomics, Inc. Methods and systems for processing polynucleotides
JP6234463B2 (en) * 2012-09-10 2017-11-22 ジーンスカイ ダイアグノスティクス(スーツォウ) インコーポレーテッドGenesky Diagnostics (Suzhou) Inc. Nucleic acid multiplex analysis method
WO2014043519A1 (en) 2012-09-14 2014-03-20 Population Diagnostics Inc. Methods and compositions for diagnosing, prognosing, and treating neurological conditions
CA2922005A1 (en) 2012-09-27 2014-04-03 Population Diagnostics, Inc. Methods and compositions for screening and treating developmental disorders
WO2014052487A1 (en) 2012-09-28 2014-04-03 Cepheid Two-primer pcr for microrna multiplex assay
CA2886974C (en) 2012-10-17 2021-06-29 Spatial Transcriptomics Ab Methods and product for optimising localised or spatial detection of gene expression in a tissue sample
EP3748016A1 (en) 2012-11-02 2020-12-09 Life Technologies Corporation Novel compositions and methods for enhancing pcr specificity
WO2014074942A1 (en) 2012-11-08 2014-05-15 Illumina, Inc. Risk variants of alzheimer's disease
US10314253B2 (en) 2012-12-04 2019-06-11 Seminis Vegetable Seeds, Inc. Methods and compositions for watermelon sex expression
CA2894381C (en) * 2012-12-07 2021-01-12 Invitae Corporation Multiplex nucleic acid detection methods
US10533221B2 (en) 2012-12-14 2020-01-14 10X Genomics, Inc. Methods and systems for processing polynucleotides
AU2013359165B2 (en) 2012-12-14 2019-09-12 10X Genomics, Inc. Methods and systems for processing polynucleotides
EP2943590A4 (en) * 2013-01-13 2017-02-15 Unitaq Bio Methods and compositions for pcr using blocked and universal primers
AU2014214682B2 (en) 2013-02-08 2018-07-26 10X Genomics, Inc. Polynucleotide barcode generation
WO2014130923A2 (en) 2013-02-25 2014-08-28 Genentech, Inc. Methods and compositions for detecting and treating drug resistant akt mutant
US9982255B2 (en) * 2013-03-11 2018-05-29 Kailos Genetics, Inc. Capture methodologies for circulating cell free DNA
CN105339505B (en) 2013-03-12 2021-08-10 生命技术公司 Universal reporter-based genotyping methods and materials
US10612088B2 (en) 2013-03-14 2020-04-07 The Broad Institute, Inc. Massively multiplexed RNA sequencing
US20140272959A1 (en) * 2013-03-14 2014-09-18 President And Fellows Of Harvard College Methods of Hybridizing Probes to Genomic DNA
EP2971123B1 (en) 2013-03-15 2021-05-05 Labrador Diagnostics LLC Nucleic acid amplification
US10294489B2 (en) 2013-03-15 2019-05-21 Board Of Trustees Of Southern Illinois University Soybean resistant to cyst nematodes
US9822408B2 (en) 2013-03-15 2017-11-21 Nugen Technologies, Inc. Sequential sequencing
EP2970961B1 (en) 2013-03-15 2019-04-24 Theranos IP Company, LLC Nucleic acid amplification
US10450595B2 (en) 2013-03-15 2019-10-22 Theranos Ip Company, Llc Nucleic acid amplification
EP2970960B1 (en) 2013-03-15 2019-03-13 Theranos IP Company, LLC Nucleic acid amplification
US10119134B2 (en) 2013-03-15 2018-11-06 Abvitro Llc Single cell bar-coding for antibody discovery
US9822418B2 (en) 2013-04-22 2017-11-21 Icahn School Of Medicine At Mount Sinai Mutations in PDGFRB and NOTCH3 as causes of autosomal dominant infantile myofibromatosis
US10059999B2 (en) 2013-06-10 2018-08-28 Monsanto Technology Llc Molecular markers associated with soybean tolerance to low iron growth conditions
CN112037860B (en) 2013-06-13 2024-02-23 豪夫迈·罗氏有限公司 Statistical analysis for non-invasive chromosome aneuploidy determination
CN111500680B (en) 2013-06-25 2024-04-16 普罗格诺西斯生物科学公司 Method and system for detecting spatial distribution of biological targets in a sample
BR112016003480B1 (en) * 2013-08-19 2022-08-16 Singular Bio, Inc ASSAYS FOR SINGLE MOLECULE DETECTION AND ITS USE
DK3039158T3 (en) 2013-08-28 2019-03-04 Becton Dickinson Co MASSIVE PARALLEL SINGLE CELL CELL ANALYSIS
US10395758B2 (en) 2013-08-30 2019-08-27 10X Genomics, Inc. Sequencing methods
EP3041957A4 (en) 2013-09-04 2017-03-29 Fluidigm Corporation Proximity assays for detecting nucleic acids and proteins in a single cell
US10767188B2 (en) 2013-09-25 2020-09-08 Nutech Ventures Methods and compositions for obtaining useful plant traits
US11901041B2 (en) 2013-10-04 2024-02-13 Bio-Rad Laboratories, Inc. Digital analysis of nucleic acid modification
US9582877B2 (en) 2013-10-07 2017-02-28 Cellular Research, Inc. Methods and systems for digitally counting features on arrays
NZ630628A (en) 2013-10-08 2015-04-24 Seminis Vegetable Seeds Inc Methods and compositions for peronospora resistance in spinach
US10006097B2 (en) 2013-10-22 2018-06-26 The United States of America, as represented by the Secretry, Department of Health and Human Services Compositions and methods for detection and discrimination of influenza viruses
EP3063129B1 (en) 2013-10-25 2019-04-17 Life Technologies Corporation Novel compounds for use in pcr systems and applications thereof
EP3511422B1 (en) 2013-11-12 2022-12-28 Population Bio, Inc. Methods and compositions for diagnosing, prognosing, and treating endometriosis
EP3068896B1 (en) 2013-11-12 2018-08-08 Life Technologies Corporation Reagents and methods for sequencing
US9546399B2 (en) 2013-11-13 2017-01-17 Nugen Technologies, Inc. Compositions and methods for identification of a duplicate sequencing read
WO2015080966A1 (en) * 2013-11-26 2015-06-04 Bio-Rad Laboratories, Inc. Methods for detecting nucleic acid proximity
NZ767892A (en) 2013-11-27 2022-07-01 Seminis Vegetable Seeds Inc Disease resistance loci in onion
US9944977B2 (en) 2013-12-12 2018-04-17 Raindance Technologies, Inc. Distinguishing rare variations in a nucleic acid sequence from a sample
US9824068B2 (en) 2013-12-16 2017-11-21 10X Genomics, Inc. Methods and apparatus for sorting data
EP2986742A4 (en) * 2014-01-10 2016-12-07 Bio Rad Laboratories Inc Intercalating dyes for differential detection
US10260111B1 (en) 2014-01-20 2019-04-16 Brett Eric Etchebarne Method of detecting sepsis-related microorganisms and detecting antibiotic-resistant sepsis-related microorganisms in a fluid sample
WO2015127201A1 (en) 2014-02-21 2015-08-27 The United States Of America, As Represented By The Secretary, Department Of Health & Human Services Hiv-2 nucleic acids and methods of detection
CN106231893B (en) 2014-02-21 2019-10-18 先正达参股股份有限公司 Genetic loci associated with increased fertility in maize
WO2015127379A1 (en) 2014-02-24 2015-08-27 Children's Hospital Medical Center Methods and compositions for personalized pain management
NZ630710A (en) 2014-02-27 2016-03-31 Seminis Vegetable Seeds Inc Compositions and methods for peronospora resistance in spinach
US9745614B2 (en) 2014-02-28 2017-08-29 Nugen Technologies, Inc. Reduced representation bisulfite sequencing with diversity adaptors
WO2015153571A2 (en) 2014-04-01 2015-10-08 Cornell University Detection of dna methylation using combined nuclease ligation reactions
US10844436B2 (en) 2014-04-01 2020-11-24 Cornell University Use of double-stranded DNA in exosomes: a novel biomarker in cancer detection
EP3792366A1 (en) * 2014-04-04 2021-03-17 Affymetrix, Inc. Improved compositions and methods for molecular inversion probe assays
WO2015157567A1 (en) 2014-04-10 2015-10-15 10X Genomics, Inc. Fluidic devices, systems, and methods for encapsulating and partitioning reagents, and applications of same
WO2015160536A1 (en) 2014-04-14 2015-10-22 The United States Of America, As Represented By The Secretary Department Of Health And Human Services Methods for rapid detection and identification of viral nucleic acids
CN107075509B (en) 2014-05-23 2021-03-09 数字基因公司 Haploid panel assay by digitizing transposons
WO2015185564A1 (en) * 2014-06-02 2015-12-10 Base4 Innovation Ltd Nucleotide polymorphism detection method
EP4170044A1 (en) * 2014-06-06 2023-04-26 Cornell University Method for identification and enumeration of nucleic acid sequence, expression, copy, or dna methylation changes, using combined nuclease, ligase, polymerase, and sequencing reactions
WO2015199976A1 (en) 2014-06-24 2015-12-30 The United States Of America, As Represented By The Secretary, Department Of Health & Human Services Target activated microdissection
JP6838969B2 (en) 2014-06-26 2021-03-03 10エックス ジェノミクス, インコーポレイテッド Method for Analyzing Nucleic Acids Derived from Individual Cells or Cell Populations
WO2015200869A1 (en) 2014-06-26 2015-12-30 10X Genomics, Inc. Analysis of nucleic acid sequences
US10316369B2 (en) 2014-06-27 2019-06-11 Seminis Vegetable Seeds, Inc. Methods and assays for male sterile watermelon
EP3175001B1 (en) 2014-07-30 2021-02-10 Mor Research Applications Ltd. Prognostic methods and systems of treatment for acute lymphoblastic leukemia
GB201413718D0 (en) * 2014-08-01 2014-09-17 Olink Ab Method for selecting a target nucleic acid sequence
US10422004B2 (en) 2014-08-08 2019-09-24 Children's Hospital Medical Center Diagnostic method for distinguishing forms of esophageal eosinophilia
ES2828959T3 (en) 2014-08-22 2021-05-28 Cepheid Methods to detect influenza
WO2016036403A1 (en) 2014-09-05 2016-03-10 Population Diagnostics Inc. Methods and compositions for inhibiting and treating neurological conditions
US11091810B2 (en) 2015-01-27 2021-08-17 BioSpyder Technologies, Inc. Focal gene expression profiling of stained FFPE tissues with spatial correlation to morphology
US9856521B2 (en) 2015-01-27 2018-01-02 BioSpyder Technologies, Inc. Ligation assays in liquid phase
US10683534B2 (en) 2015-01-27 2020-06-16 BioSpyder Technologies, Inc. Ligation assays in liquid phase
AU2015318011B2 (en) 2014-09-15 2020-07-23 Abvitro Llc High-throughput nucleotide library sequencing
CN113736863A (en) * 2014-09-17 2021-12-03 赛拉诺斯知识产权有限责任公司 Diagnostic methods and compositions
CN107002145B (en) * 2014-10-08 2021-07-30 康奈尔大学 A method for identifying one or more nucleic acid molecules containing a target nucleotide sequence in a sample
EP3005862A1 (en) 2014-10-10 2016-04-13 Seminis Vegetable Seeds, Inc. Melon plants with improved disease tolerance
EP3207156A1 (en) 2014-10-13 2017-08-23 Life Technologies Corporation Methods, kits & compositions for determining gene copy numbers
WO2016069853A2 (en) 2014-10-30 2016-05-06 Cepheid Methods of detecting ebola
US9975122B2 (en) 2014-11-05 2018-05-22 10X Genomics, Inc. Instrument systems for integrated sample processing
US10697004B2 (en) * 2014-11-06 2020-06-30 Osaka City University Clamping probe
WO2016077687A1 (en) 2014-11-14 2016-05-19 Voyager Therapeutics, Inc. Compositions and methods of treating amyotrophic lateral sclerosis (als)
WO2016089920A1 (en) 2014-12-01 2016-06-09 The Broad Institute, Inc. Method for in situ determination of nucleic acid proximity
US10085951B2 (en) 2014-12-11 2018-10-02 Designs For Health, Inc. Curcuminoid formulations and related methods of treatment
WO2016100388A1 (en) 2014-12-15 2016-06-23 Cepheid Exponential base-greater-than-2 nucleic acid amplification
CN107109398B (en) * 2014-12-19 2020-08-18 荣研化学株式会社 Oligonucleotide probe for detecting single nucleotide polymorphism and method for detecting single nucleotide polymorphism
KR101728023B1 (en) * 2015-01-02 2017-04-18 주식회사 랩 지노믹스 Detection of mutations in ATP7B gene using PCR-LDR
CA2972969A1 (en) 2015-01-12 2016-07-21 10X Genomics, Inc. Processes and systems for preparing nucleic acid sequencing libraries and libraries prepared using same
US9984201B2 (en) 2015-01-18 2018-05-29 Youhealth Biotech, Limited Method and system for determining cancer status
US11639522B2 (en) * 2015-01-30 2023-05-02 President And Fellows Of Harvard College Microscope-free imaging
JP6580331B2 (en) * 2015-01-30 2019-09-25 倉敷紡績株式会社 Method for preparing single-stranded DNA product
EP3766988B1 (en) 2015-02-19 2024-02-14 Becton, Dickinson and Company High-throughput single-cell analysis combining proteomic and genomic information
WO2016137973A1 (en) 2015-02-24 2016-09-01 10X Genomics Inc Partition processing methods and systems
US20160246813A1 (en) * 2015-02-25 2016-08-25 International Business Machines Corporation System and method for machine information life cycle
JP2018509896A (en) 2015-02-27 2018-04-12 フリューダイム・コーポレイション Single-cell nucleic acids for high-throughput studies
EP3262192B1 (en) 2015-02-27 2020-09-16 Becton, Dickinson and Company Spatially addressable molecular barcoding
EP3268462B1 (en) 2015-03-11 2021-08-11 The Broad Institute, Inc. Genotype and phenotype coupling
US9434996B1 (en) 2015-03-13 2016-09-06 Tracy Ann Hayden All mini-STR multiplex with increased C.E. through-put by STR prolongation template fusion
EP3277843A2 (en) 2015-03-30 2018-02-07 Cellular Research, Inc. Methods and compositions for combinatorial barcoding
US20160299129A1 (en) * 2015-04-07 2016-10-13 Xiaolei Qiu Ultra Sensitive and Specific Multiplex Biosensor System Based on Multiple Cooperative Interactions
CN107532207B (en) 2015-04-10 2021-05-07 空间转录公司 Spatially differentiated, multiplexed nucleic acid analysis of biological samples
EP3286326B1 (en) * 2015-04-23 2025-01-22 Becton, Dickinson and Company Method for whole transcriptome amplification
WO2016170121A1 (en) * 2015-04-23 2016-10-27 Pathofinder B.V. Method for the simultaneous detection of multiple nucleic acid sequences in a sample
UA126271C2 (en) 2015-04-28 2022-09-14 Монсанто Текнолоджі Елелсі METHOD OF OBTAINING SHORTENED CORN PLANTS
UA126326C2 (en) 2015-04-30 2022-09-21 Монсанто Текнолоджі Елелсі Methods for producing canola plants with clubroot resistance and compositions thereof
US11124823B2 (en) 2015-06-01 2021-09-21 Becton, Dickinson And Company Methods for RNA quantification
AU2016277943B2 (en) 2015-06-15 2022-09-01 Cepheid Integrated purification and measurement of DNA methylation and co-measurement of mutations and/or mRNA expression levels in an automated reaction cartridge
CN108350500A (en) 2015-07-29 2018-07-31 普罗格尼迪公司 Nucleic acid for detecting chromosome abnormality and method
US11214800B2 (en) 2015-08-18 2022-01-04 The Broad Institute, Inc. Methods and compositions for altering function and structure of chromatin loops and/or domains
CR20180164A (en) 2015-08-18 2018-09-04 Monsanto Technology Llc METHODS TO PRODUCE COTTON PLANTS WITH IMPROVED DROUGHT TOLERANCE AND COMPOSITIONS OF THESE
US10448595B2 (en) 2015-09-03 2019-10-22 Seminis Vegetable Seeds, Inc. Downy mildew resistant lettuce plants
US11118216B2 (en) 2015-09-08 2021-09-14 Affymetrix, Inc. Nucleic acid analysis by joining barcoded polynucleotide probes
WO2017044744A2 (en) 2015-09-10 2017-03-16 Monsanto Technology Llc Methods for producing corn plants with downy mildew resistance and compositions thereof
ES2745694T3 (en) 2015-09-11 2020-03-03 Cellular Res Inc Methods and compositions for nucleic acid library normalization
CN108291257B (en) 2015-09-24 2023-12-29 阿布维特罗有限责任公司 Affinity oligonucleotides conjugate and use thereof
US20180274021A1 (en) 2015-09-24 2018-09-27 Abvitro Llc Single amplicon activated exclusion pcr
CN108369230B (en) 2015-09-25 2021-09-17 阿布维特罗有限责任公司 High throughput method for T cell receptor targeted identification of naturally paired T cell receptor sequences
US11273151B2 (en) 2015-11-04 2022-03-15 Icahn School Of Medicine At Mount Sinai Methods of treating tumors and cancer, and identifying candidate subjects for such treatment
CN108779487A (en) 2015-11-16 2018-11-09 普罗格尼迪公司 Nucleic acid for detecting methylation state and method
US11371094B2 (en) 2015-11-19 2022-06-28 10X Genomics, Inc. Systems and methods for nucleic acid processing using degenerate nucleotides
EP3377657B1 (en) * 2015-11-19 2020-11-11 10X Genomics, Inc. Transformable tagging methods
JP6703824B2 (en) * 2015-11-30 2020-06-03 シスメックス株式会社 Cell selection method, cell detection method, cell selection device, and cell detection device
CN115369161A (en) 2015-12-04 2022-11-22 10X 基因组学有限公司 Methods and compositions for nucleic acid analysis
CN108603224B (en) 2015-12-16 2022-06-28 富鲁达公司 High level multiplexed amplification
CA3006080A1 (en) 2015-12-18 2017-06-22 Monsanto Technology Llc Methods for producing corn plants with northern leaf blight resistance and compositions thereof
US10894985B2 (en) 2016-01-12 2021-01-19 Sitokine Limited Methods for predicting response to treatment
EP3402572B1 (en) 2016-01-13 2022-03-16 Children's Hospital Medical Center Compositions and methods for treating allergic inflammatory conditions
WO2017138984A1 (en) 2016-02-11 2017-08-17 10X Genomics, Inc. Systems, methods, and media for de novo assembly of whole genome sequence data
WO2017189730A1 (en) 2016-04-26 2017-11-02 Icahn School Of Medicine At Mount Sinai Treatment of hippo pathway mutant tumors and methods of identifying subjects as candidates for treatment
WO2017189906A1 (en) 2016-04-27 2017-11-02 Mira Dx, Inc. Immune-based treatment of kras-variant cancer patients
JP7129343B2 (en) 2016-05-02 2022-09-01 ベクトン・ディキンソン・アンド・カンパニー Accurate molecular barcoding
WO2017197338A1 (en) 2016-05-13 2017-11-16 10X Genomics, Inc. Microfluidic systems and methods of use
US10301677B2 (en) 2016-05-25 2019-05-28 Cellular Research, Inc. Normalization of nucleic acid libraries
EP3465502B1 (en) 2016-05-26 2024-04-10 Becton, Dickinson and Company Molecular label counting adjustment methods
US10640763B2 (en) 2016-05-31 2020-05-05 Cellular Research, Inc. Molecular indexing of internal sequences
US10202641B2 (en) 2016-05-31 2019-02-12 Cellular Research, Inc. Error correction in amplification of samples
EP3464642A4 (en) 2016-05-31 2020-02-19 The Regents of the University of California METHOD FOR EVALUATING, MONITORING AND MODULATING THE AGING PROCESS
EP3472349A1 (en) 2016-06-16 2019-04-24 Life Technologies Corporation Novel compositions, methods and kits for microorganism detection
US11248272B2 (en) 2016-06-27 2022-02-15 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Methods and compositions for influenza a virus subtyping
US10093986B2 (en) 2016-07-06 2018-10-09 Youhealth Biotech, Limited Leukemia methylation markers and uses thereof
WO2018009703A1 (en) 2016-07-06 2018-01-11 Youhealth Biotech, Limited Breast and ovarian cancer methylation markers and uses thereof
EP3481403B1 (en) 2016-07-06 2022-02-09 Youhealth Biotech, Limited Solid tumor methylation markers and uses thereof
US10822648B1 (en) 2016-07-29 2020-11-03 Labrador Diagnostics Llc Hybrid multi-step nucleic acid amplification
EP3496528A4 (en) 2016-08-11 2020-03-18 Monsanto Technology LLC METHODS AND COMPOSITIONS FOR PRODUCING CORN PLANTS WITH RESISTANCE TO LATE FAILURE
EP3504342A1 (en) 2016-08-26 2019-07-03 Life Technologies Corporation Nucleic acid extraction and amplification controls and methods of use thereof
US12209292B2 (en) 2016-08-26 2025-01-28 The Broad Institute, Inc. Nucleic acid amplification assays for detection of pathogens
CN109923213B (en) 2016-09-20 2023-02-28 哈佛学院院长及董事 molecular verification system
JP6929354B2 (en) 2016-09-24 2021-09-01 アブビトロ, エルエルシー Affinity-oligonucleotide conjugates and their use
JP7091348B2 (en) 2016-09-26 2022-06-27 ベクトン・ディキンソン・アンド・カンパニー Measurement of protein expression using reagents with barcoded oligonucleotide sequences
AU2017232187B2 (en) 2016-09-30 2023-11-09 Seminis Vegetable Seeds, Inc. Xanthomonas resistant brassica oleracea plants
US11725232B2 (en) 2016-10-31 2023-08-15 The Hong Kong University Of Science And Technology Compositions, methods and kits for detection of genetic variants for alzheimer's disease
BR112019011378A2 (en) 2016-12-06 2019-10-15 Univ Oregon State compositions and methods for the potentiated production of enduracidin in a genetically modified streptomyces fungicidicus strain
AU2017376118B2 (en) 2016-12-12 2022-09-01 Cepheid Integrated purification and measurement of DNA methylation and co-measurement of mutations and/or mRNA expression levels in an automated reaction cartridge
WO2018111782A1 (en) 2016-12-12 2018-06-21 Cepheid Integrated immuno-pcr and nucleic acid analysis in an automated reaction cartridge
WO2018118808A1 (en) 2016-12-19 2018-06-28 The Broad Institute, Inc. Methods of treating autism spectrum disorders
US10815525B2 (en) 2016-12-22 2020-10-27 10X Genomics, Inc. Methods and systems for processing polynucleotides
US10550429B2 (en) 2016-12-22 2020-02-04 10X Genomics, Inc. Methods and systems for processing polynucleotides
EP3565906B1 (en) 2017-01-05 2021-01-27 Tervisetehnoloogiate Arenduskeskus AS Quantifying dna sequences
US10337070B2 (en) 2017-01-12 2019-07-02 Cardioforecast Ltd. Methods and kits for treating cardiovascular disease
JP7104048B2 (en) 2017-01-13 2022-07-20 セルラー リサーチ, インコーポレイテッド Hydrophilic coating of fluid channels
EP3571309A4 (en) 2017-01-20 2020-11-25 Children's Hospital Medical Center PROCEDURES AND COMPOSITIONS RELATED TO OPRM1 DNA METHYLATION FOR PERSONALIZED PAIN MANAGEMENT
US12264411B2 (en) 2017-01-30 2025-04-01 10X Genomics, Inc. Methods and systems for analysis
CN110214186B (en) 2017-01-30 2023-11-24 10X基因组学有限公司 Methods and systems for droplet-based single cell barcoding
EP3577232A1 (en) 2017-02-01 2019-12-11 Cellular Research, Inc. Selective amplification using blocking oligonucleotides
US10240205B2 (en) 2017-02-03 2019-03-26 Population Bio, Inc. Methods for assessing risk of developing a viral disease using a genetic test
US10995333B2 (en) 2017-02-06 2021-05-04 10X Genomics, Inc. Systems and methods for nucleic acid preparation
WO2018161031A1 (en) 2017-03-02 2018-09-07 Youhealth Biotech, Limited Methylation markers for diagnosing hepatocellular carcinoma and lung cancer
EP3378950A1 (en) * 2017-03-21 2018-09-26 Sequencing Multiplex SLK Easy one-step amplification and labeling (eosal)
CN110446787A (en) 2017-03-24 2019-11-12 生物辐射实验室股份有限公司 General clamp primers
CN110536969A (en) 2017-04-24 2019-12-03 豪夫迈·罗氏有限公司 ERBB2/HER2 mutations in the transmembrane or juxtamembrane domain
WO2018204175A1 (en) 2017-05-03 2018-11-08 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Rapid detection of zika virus by reverse transcription loop-mediated isothermal amplification
AU2018261790B2 (en) 2017-05-05 2024-10-03 Voyager Therapeutics, Inc. Compositions and methods of treating amyotrophic lateral sclerosis (ALS)
WO2018213803A1 (en) 2017-05-19 2018-11-22 Neon Therapeutics, Inc. Immunogenic neoantigen identification
MA49352A (en) 2017-05-26 2020-04-08 Abvitro Llc HIGH YIELD POLYNUCLEOTIDE LIBRARY SEQUENCING AND TRANSCRIPTOME ANALYSIS
CN116064732A (en) 2017-05-26 2023-05-05 10X基因组学有限公司 Single-cell analysis of transposase-accessible chromatin
US20180340169A1 (en) 2017-05-26 2018-11-29 10X Genomics, Inc. Single cell analysis of transposase accessible chromatin
CA3059559A1 (en) 2017-06-05 2018-12-13 Becton, Dickinson And Company Sample indexing for single cells
US11466329B2 (en) 2017-06-14 2022-10-11 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Detection of blaIMP antibacterial resistance genes
US20200292526A1 (en) 2017-09-07 2020-09-17 Juno Therapeutics, Inc. Methods of identifying cellular attributes related to outcomes associated with cell therapy
WO2019055829A1 (en) 2017-09-15 2019-03-21 Nazarian Javad Methods for detecting cancer biomarkers
AU2018335575B2 (en) 2017-09-25 2024-07-04 Fred Hutchinson Cancer Center High efficiency targeted in situ genome-wide profiling
US10837047B2 (en) 2017-10-04 2020-11-17 10X Genomics, Inc. Compositions, methods, and systems for bead formation using improved polymers
WO2019071054A1 (en) 2017-10-04 2019-04-11 The Broad Institute, Inc. Methods and compositions for altering function and structure of chromatin loops and/or domains
CN111479924B (en) 2017-10-16 2024-06-14 沃雅戈治疗公司 Treatment of Amyotrophic Lateral Sclerosis (ALS)
US11099202B2 (en) 2017-10-20 2021-08-24 Tecan Genomics, Inc. Reagent delivery system
WO2019084043A1 (en) 2017-10-26 2019-05-02 10X Genomics, Inc. Methods and systems for nuclecic acid preparation and chromatin analysis
CN111479631B (en) 2017-10-27 2022-02-22 10X基因组学有限公司 Methods and systems for sample preparation and analysis
WO2019094973A1 (en) 2017-11-13 2019-05-16 Life Technologies Corporation Compositions, methods and kits for urinary tract microorganism detection
WO2019099751A1 (en) 2017-11-15 2019-05-23 10X Genomics, Inc. Functionalized gel beads
US10829815B2 (en) 2017-11-17 2020-11-10 10X Genomics, Inc. Methods and systems for associating physical and genetic properties of biological particles
WO2019108851A1 (en) 2017-11-30 2019-06-06 10X Genomics, Inc. Systems and methods for nucleic acid preparation and analysis
WO2019126209A1 (en) 2017-12-19 2019-06-27 Cellular Research, Inc. Particles associated with oligonucleotides
CN118547046A (en) 2017-12-22 2024-08-27 10X基因组学有限公司 Systems and methods for processing nucleic acid molecules from one or more cells
WO2019133727A1 (en) 2017-12-29 2019-07-04 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Universal influenza virus probe set for enrichment of any influenza virus nucleic acid
US11814674B2 (en) 2018-02-02 2023-11-14 The United States Of America, As Represented By The Secretary Department Of Health And Human Services Random amplification methods for extremely low input nucleic acids
WO2019157529A1 (en) 2018-02-12 2019-08-15 10X Genomics, Inc. Methods characterizing multiple analytes from individual cells or cell populations
EP3752645A4 (en) 2018-02-14 2022-04-13 Dermtech, Inc. NEW GENE CLASSIFIERS AND THEIR USE IN NON-MELANOMA SKIN CANCER
US11639928B2 (en) 2018-02-22 2023-05-02 10X Genomics, Inc. Methods and systems for characterizing analytes from individual cells or cell populations
US11859250B1 (en) 2018-02-23 2024-01-02 Children's Hospital Medical Center Methods for treating eosinophilic esophagitis
WO2019169028A1 (en) 2018-02-28 2019-09-06 10X Genomics, Inc. Transcriptome sequencing through random ligation
AU2019240244A1 (en) 2018-03-22 2020-11-19 President And Fellows Of Harvard College Methods and compositions for molecular authentication
EP3775272A4 (en) 2018-04-02 2021-12-29 Progenity, Inc. Methods, systems, and compositions for counting nucleic acid molecules
WO2019195166A1 (en) 2018-04-06 2019-10-10 10X Genomics, Inc. Systems and methods for quality control in single cell processing
AU2019256617B2 (en) * 2018-04-20 2022-09-29 Longhorn Vaccines And Diagnostics, Llc Rapid methods for the detection of microbial resistance
EP4234717A3 (en) 2018-05-03 2023-11-01 Becton, Dickinson and Company High throughput multiomics sample analysis
EP4545647A2 (en) 2018-05-03 2025-04-30 Becton, Dickinson and Company Molecular barcoding on opposite transcript ends
WO2019213619A1 (en) 2018-05-04 2019-11-07 Abbott Laboratories Hbv diagnostic, prognostic, and therapeutic methods and products
CN108531599A (en) * 2018-05-08 2018-09-14 杭州泰领生物技术有限公司 A kind of kit and method of people HLA-B*5801 genotype
WO2019217758A1 (en) 2018-05-10 2019-11-14 10X Genomics, Inc. Methods and systems for molecular library generation
US11268102B2 (en) 2018-05-16 2022-03-08 University Of Florida Research Foundation, Incorporated Compositions and methods for identifying and selecting brachytic locus in solanaceae
US11932899B2 (en) 2018-06-07 2024-03-19 10X Genomics, Inc. Methods and systems for characterizing nucleic acid molecules
WO2019238765A1 (en) 2018-06-12 2019-12-19 Keygene N.V. Nucleic acid amplification method
US11703427B2 (en) 2018-06-25 2023-07-18 10X Genomics, Inc. Methods and systems for cell and bead processing
US12188014B1 (en) 2018-07-25 2025-01-07 10X Genomics, Inc. Compositions and methods for nucleic acid processing using blocking agents
US20200032335A1 (en) 2018-07-27 2020-01-30 10X Genomics, Inc. Systems and methods for metabolome analysis
EP3829569A4 (en) 2018-07-27 2022-04-27 Aperta Biosciences, LLC Spinosyn formulations for treatment of demodex-induced ocular and facial conditions
CN112703252B (en) 2018-08-03 2024-09-10 10X基因组学有限公司 Method and system for minimizing bar code exchanges
CA3108807A1 (en) 2018-08-08 2020-02-13 Pml Screening, Llc Methods for assessing the risk of developing progressive multifocal leukoencephalopathy caused by john cunningham virus by genetic testing
US12065688B2 (en) 2018-08-20 2024-08-20 10X Genomics, Inc. Compositions and methods for cellular processing
WO2020041148A1 (en) 2018-08-20 2020-02-27 10X Genomics, Inc. Methods and systems for detection of protein-dna interactions using proximity ligation
US11519033B2 (en) 2018-08-28 2022-12-06 10X Genomics, Inc. Method for transposase-mediated spatial tagging and analyzing genomic DNA in a biological sample
CN112805389B (en) 2018-10-01 2024-08-06 贝克顿迪金森公司 Determine 5' transcript sequence
CA3118000A1 (en) 2018-10-29 2020-05-07 Cepheid Exponential base-3 nucleic acid amplification with reduced amplification time using nested overlapping primers
JP7618548B2 (en) 2018-11-08 2025-01-21 ベクトン・ディキンソン・アンド・カンパニー Whole-transcriptome analysis of single cells using random priming
US11459607B1 (en) 2018-12-10 2022-10-04 10X Genomics, Inc. Systems and methods for processing-nucleic acid molecules from a single cell using sequential co-partitioning and composite barcodes
CN113767177B (en) 2018-12-10 2025-01-14 10X基因组学有限公司 Generation of capture probes for spatial analysis
EP3894552A1 (en) 2018-12-13 2021-10-20 Becton, Dickinson and Company Selective extension in single cell whole transcriptome analysis
US11926867B2 (en) 2019-01-06 2024-03-12 10X Genomics, Inc. Generating capture probes for spatial analysis
US11649485B2 (en) 2019-01-06 2023-05-16 10X Genomics, Inc. Generating capture probes for spatial analysis
US12169198B2 (en) 2019-01-08 2024-12-17 10X Genomics, Inc. Systems and methods for sample analysis
US11845983B1 (en) 2019-01-09 2023-12-19 10X Genomics, Inc. Methods and systems for multiplexing of droplet based assays
AU2020208190B2 (en) 2019-01-15 2022-07-28 Seminis Vegetable Seeds, Inc. Green bean plants with improved disease resistance
US11371076B2 (en) 2019-01-16 2022-06-28 Becton, Dickinson And Company Polymerase chain reaction normalization through primer titration
US11661631B2 (en) 2019-01-23 2023-05-30 Becton, Dickinson And Company Oligonucleotides associated with antibodies
US11467153B2 (en) 2019-02-12 2022-10-11 10X Genomics, Inc. Methods for processing nucleic acid molecules
US11851683B1 (en) 2019-02-12 2023-12-26 10X Genomics, Inc. Methods and systems for selective analysis of cellular samples
US11584953B2 (en) 2019-02-12 2023-02-21 10X Genomics, Inc. Methods for processing nucleic acid molecules
US12275993B2 (en) 2019-02-12 2025-04-15 10X Genomics, Inc. Analysis of nucleic acid sequences
CN113454234B (en) 2019-02-14 2025-03-18 贝克顿迪金森公司 Heterozygote targeted and whole transcriptome amplification
CN113474466A (en) 2019-02-21 2021-10-01 主基因有限公司 Polyploid genotyping
US11655499B1 (en) 2019-02-25 2023-05-23 10X Genomics, Inc. Detection of sequence elements in nucleic acid molecules
US11920183B2 (en) 2019-03-11 2024-03-05 10X Genomics, Inc. Systems and methods for processing optically tagged beads
JP2022524641A (en) 2019-03-26 2022-05-09 ダームテック,インク. New gene classifiers and their use in skin cancer
WO2020193769A1 (en) * 2019-03-27 2020-10-01 Diagenode S.A. A high throughput sequencing method and kit
WO2020206170A1 (en) 2019-04-02 2020-10-08 Progenity, Inc. Methods, systems, and compositions for counting nucleic acid molecules
US20220262462A1 (en) 2019-04-10 2022-08-18 University Of Pittsburgh - Of The Commonwealth System Of Higher Education Computational filtering of methylated sequence data for predictive modeling
US11965208B2 (en) 2019-04-19 2024-04-23 Becton, Dickinson And Company Methods of associating phenotypical data and single cell sequencing data
EP3976820A1 (en) 2019-05-30 2022-04-06 10X Genomics, Inc. Methods of detecting spatial heterogeneity of a biological sample
US20220249660A1 (en) 2019-06-06 2022-08-11 Sitokine Limited Compositions and methods for treating lung, colorectal and breast cancer
CN114051534B (en) 2019-07-22 2025-02-21 贝克顿迪金森公司 Single-cell chromatin immunoprecipitation sequencing assay
WO2021028469A1 (en) 2019-08-12 2021-02-18 Sitokine Limited Compositions and methods for treating cytokine release syndrome and neurotoxicity
US12235262B1 (en) 2019-09-09 2025-02-25 10X Genomics, Inc. Methods and systems for single cell protein analysis
US11287422B2 (en) 2019-09-23 2022-03-29 Element Biosciences, Inc. Multivalent binding composition for nucleic acid analysis
US11542513B2 (en) 2019-09-26 2023-01-03 Seminis Vegetable Seeds, Inc. Lettuce plants having resistance to Nasonovia ribisnigri biotype Nr:1
US11844800B2 (en) 2019-10-30 2023-12-19 Massachusetts Institute Of Technology Methods and compositions for predicting and preventing relapse of acute lymphoblastic leukemia
EP3901286A1 (en) 2020-04-24 2021-10-27 Mirnax Biosens, S.L. Bivalent reverse primer
US20220389497A1 (en) 2019-11-04 2022-12-08 Mirnax Biosens, S.L. Bivalent reverse primer
EP4055185A1 (en) 2019-11-08 2022-09-14 10X Genomics, Inc. Spatially-tagged analyte capture agents for analyte multiplexing
WO2021092433A2 (en) 2019-11-08 2021-05-14 10X Genomics, Inc. Enhancing specificity of analyte binding
US11773436B2 (en) 2019-11-08 2023-10-03 Becton, Dickinson And Company Using random priming to obtain full-length V(D)J information for immune repertoire sequencing
CN115038794A (en) 2019-12-23 2022-09-09 10X基因组学有限公司 Compositions and methods for using fixed biological samples in partition-based assays
SG11202106899SA (en) 2019-12-23 2021-09-29 10X Genomics Inc Methods for spatial analysis using rna-templated ligation
CN115244184A (en) 2020-01-13 2022-10-25 贝克顿迪金森公司 Methods and compositions for quantification of protein and RNA
US11702693B2 (en) 2020-01-21 2023-07-18 10X Genomics, Inc. Methods for printing cells and generating arrays of barcoded cells
US11732299B2 (en) 2020-01-21 2023-08-22 10X Genomics, Inc. Spatial assays with perturbed cells
US11821035B1 (en) 2020-01-29 2023-11-21 10X Genomics, Inc. Compositions and methods of making gene expression libraries
EP4471155A3 (en) 2020-01-29 2024-12-18 Becton, Dickinson and Company Barcoded wells for spatial mapping of single cells through sequencing
US12076701B2 (en) 2020-01-31 2024-09-03 10X Genomics, Inc. Capturing oligonucleotides in spatial transcriptomics
CN113275053A (en) 2020-02-03 2021-08-20 帝肯基因组学公司 Reagent storage system
US11898205B2 (en) 2020-02-03 2024-02-13 10X Genomics, Inc. Increasing capture efficiency of spatial assays
US12110541B2 (en) 2020-02-03 2024-10-08 10X Genomics, Inc. Methods for preparing high-resolution spatial arrays
US11732300B2 (en) 2020-02-05 2023-08-22 10X Genomics, Inc. Increasing efficiency of spatial analysis in a biological sample
US12129516B2 (en) 2020-02-07 2024-10-29 10X Genomics, Inc. Quantitative and automated permeabilization performance evaluation for spatial transcriptomics
US11835462B2 (en) 2020-02-11 2023-12-05 10X Genomics, Inc. Methods and compositions for partitioning a biological sample
US12281357B1 (en) 2020-02-14 2025-04-22 10X Genomics, Inc. In situ spatial barcoding
US11891654B2 (en) 2020-02-24 2024-02-06 10X Genomics, Inc. Methods of making gene expression libraries
CN115151810A (en) 2020-02-25 2022-10-04 贝克顿迪金森公司 Enables bispecific probes using single-cell samples as single-color compensation controls
US11926863B1 (en) 2020-02-27 2024-03-12 10X Genomics, Inc. Solid state single cell method for analyzing fixed biological cells
US11768175B1 (en) 2020-03-04 2023-09-26 10X Genomics, Inc. Electrophoretic methods for spatial analysis
WO2021205013A1 (en) 2020-04-09 2021-10-14 Sitokine Limited Compositions and methods for treating covid-19
ES2965354T3 (en) 2020-04-22 2024-04-12 10X Genomics Inc Methods for spatial analysis using targeted RNA deletion
US11851700B1 (en) 2020-05-13 2023-12-26 10X Genomics, Inc. Methods, kits, and compositions for processing extracellular molecules
EP4150118A1 (en) 2020-05-14 2023-03-22 Becton Dickinson and Company Primers for immune repertoire profiling
EP4153775B1 (en) 2020-05-22 2024-07-24 10X Genomics, Inc. Simultaneous spatio-temporal measurement of gene expression and cellular activity
EP4153776B1 (en) 2020-05-22 2025-03-05 10X Genomics, Inc. Spatial analysis to detect sequence variants
WO2021242834A1 (en) 2020-05-26 2021-12-02 10X Genomics, Inc. Method for resetting an array
CN116249785A (en) 2020-06-02 2023-06-09 10X基因组学有限公司 Spatial Transcriptomics for Antigen-Receptors
EP4158055B1 (en) 2020-06-02 2024-03-27 Becton, Dickinson and Company Oligonucleotides and beads for 5 prime gene expression assay
US12265079B1 (en) 2020-06-02 2025-04-01 10X Genomics, Inc. Systems and methods for detecting analytes from captured single biological particles
WO2021247543A2 (en) 2020-06-02 2021-12-09 10X Genomics, Inc. Nucleic acid library methods
US12031177B1 (en) 2020-06-04 2024-07-09 10X Genomics, Inc. Methods of enhancing spatial resolution of transcripts
ES2981265T3 (en) 2020-06-08 2024-10-08 10X Genomics Inc Methods for determining a surgical margin and methods of using it
EP4165207B1 (en) 2020-06-10 2024-09-25 10X Genomics, Inc. Methods for determining a location of an analyte in a biological sample
EP4172362B1 (en) 2020-06-25 2024-09-18 10X Genomics, Inc. Spatial analysis of dna methylation
CA3183566A1 (en) 2020-06-26 2021-12-30 Victor Chu Methods of detecting sars-cov-2, influenza, and rsv
US12209280B1 (en) 2020-07-06 2025-01-28 10X Genomics, Inc. Methods of identifying abundance and location of an analyte in a biological sample using second strand synthesis
US11761038B1 (en) 2020-07-06 2023-09-19 10X Genomics, Inc. Methods for identifying a location of an RNA in a biological sample
US11981960B1 (en) 2020-07-06 2024-05-14 10X Genomics, Inc. Spatial analysis utilizing degradable hydrogels
US11932901B2 (en) 2020-07-13 2024-03-19 Becton, Dickinson And Company Target enrichment using nucleic acid probes for scRNAseq
AU2021204717A1 (en) 2020-07-15 2022-02-03 Seminis Vegetable Seeds, Inc. Green Bean Plants with Improved Disease Resistance
CN116323965A (en) 2020-07-23 2023-06-23 生命技术公司 Compositions, systems and methods for bioassays using dyes
US20240060117A1 (en) 2020-07-23 2024-02-22 Life Technologies Corporation Energy transfer dye conjugates for use in biological assays
US11981958B1 (en) 2020-08-20 2024-05-14 10X Genomics, Inc. Methods for spatial analysis using DNA capture
WO2022047328A1 (en) * 2020-08-31 2022-03-03 Applied Materials, Inc. Slides for calibration of mfish
WO2022056078A1 (en) 2020-09-11 2022-03-17 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Rnase h-assisted detection assay for rna (radar)
CN116194590A (en) 2020-09-18 2023-05-30 10X基因组学有限公司 Sample processing apparatus and image registration method
JP2023543424A (en) 2020-09-21 2023-10-16 ビオラ・セラピューティクス・インコーポレイテッド Compositions and methods for isolating cell-free DNA
US11926822B1 (en) 2020-09-23 2024-03-12 10X Genomics, Inc. Three-dimensional spatial analysis
WO2022076428A1 (en) 2020-10-06 2022-04-14 Cepheid Methods of diagnosing tuberculosis and differentiating between active and latent tuberculosis
US12084715B1 (en) 2020-11-05 2024-09-10 10X Genomics, Inc. Methods and systems for reducing artifactual antisense products
US11827935B1 (en) 2020-11-19 2023-11-28 10X Genomics, Inc. Methods for spatial analysis using rolling circle amplification and detection probes
CN116635533A (en) 2020-11-20 2023-08-22 贝克顿迪金森公司 Profiling of high and low expressed proteins
EP4121555A1 (en) 2020-12-21 2023-01-25 10X Genomics, Inc. Methods, compositions, and systems for capturing probes and/or barcodes
EP4294571B8 (en) 2021-02-19 2024-07-10 10X Genomics, Inc. Method of using a modular assay support device
EP4298244A1 (en) 2021-02-23 2024-01-03 10X Genomics, Inc. Probe-based analysis of nucleic acids and proteins
ES3008686T3 (en) 2021-03-18 2025-03-24 10X Genomics Inc Multiplex capture of gene and protein expression from a biological sample
EP4305196B1 (en) 2021-04-14 2025-04-02 10X Genomics, Inc. Methods of measuring mislocalization of an analyte
EP4347879B1 (en) 2021-06-03 2025-02-19 10X Genomics, Inc. Methods, compositions, kits, and systems for enhancing analyte capture for spatial analysis
EP4196605B1 (en) 2021-09-01 2024-12-04 10X Genomics, Inc. Methods for blocking a capture probe on a spatial array
CN117106887A (en) 2021-10-22 2023-11-24 塞弗德公司 Compositions and methods for diagnosing and treating tuberculosis
EP4419707A1 (en) 2021-11-10 2024-08-28 10X Genomics, Inc. Methods, compositions, and kits for determining the location of an analyte in a biological sample
WO2023102118A2 (en) 2021-12-01 2023-06-08 10X Genomics, Inc. Methods, compositions, and systems for improved in situ detection of analytes and spatial analysis
US20230193310A1 (en) 2021-12-10 2023-06-22 Seminis Vegetabe Seeds, Inc. Lettuce plants having resistance to downy mildew
EP4441711A1 (en) 2021-12-20 2024-10-09 10X Genomics, Inc. Self-test for pathology/histology slide imaging device
AU2023263416A1 (en) 2022-04-29 2024-11-07 Cepheid Nucleic acid extraction and isolation with heat labile silanes and chemically modified solid supports
KR20250017227A (en) 2022-05-19 2025-02-04 세페이드 MVP Cartridges and How to Use and Make Them
US20230404003A1 (en) 2022-06-21 2023-12-21 Seminis Vegetable Seeds, Inc. Novel qtls conferring resistance to cucumber mosaic virus
AU2023343487A1 (en) 2022-09-15 2025-03-20 Abbott Laboratories Hbv diagnostic, prognostic, and therapeutic methods and products
WO2024129998A2 (en) 2022-12-16 2024-06-20 Cepheid Mpox clade ii biomarker panel
WO2024158797A1 (en) 2023-01-23 2024-08-02 Next Gen Diagnostics Llc Methods for the rapid identification of cefepime-resistance in escherichia coli
US20240401157A1 (en) 2023-01-30 2024-12-05 Cepheid Respiratory biomarker panel
WO2024191684A1 (en) 2023-03-10 2024-09-19 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Detection of hepatitis c virus ribonucleic acid from whole blood using reverse transcription loop-mediated isothermal amplification
US20240344079A1 (en) 2023-04-14 2024-10-17 Seminis Vegetable Seeds, Inc. Methods and compositions for peronospora resistance in spinach
WO2025006633A1 (en) 2023-06-27 2025-01-02 Cepheid Pancoronavirus biomarker panel
WO2025064410A1 (en) 2023-09-18 2025-03-27 Cepheid Three-phase nested amplification and multi-phasic detection

Family Cites Families (129)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5258506A (en) * 1984-10-16 1993-11-02 Chiron Corporation Photolabile reagents for incorporation into oligonucleotide chains
US4883750A (en) * 1984-12-13 1989-11-28 Applied Biosystems, Inc. Detection of specific sequences in nucleic acids
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4925785A (en) 1986-03-07 1990-05-15 Biotechnica Diagnostics, Inc. Nucleic acid hybridization assays
US5525464A (en) 1987-04-01 1996-06-11 Hyseq, Inc. Method of sequencing by hybridization of oligonucleotide probes
US5202231A (en) * 1987-04-01 1993-04-13 Drmanac Radoje T Method of sequencing of genomes by hybridization of oligonucleotide probes
EP0359789B1 (en) 1988-01-21 1993-08-04 Genentech, Inc. Amplification and detection of nucleic acid sequences
GB8810400D0 (en) * 1988-05-03 1988-06-08 Southern E Analysing polynucleotide sequences
US4988617A (en) * 1988-03-25 1991-01-29 California Institute Of Technology Method of detecting a nucleotide change in nucleic acids
US5700637A (en) 1988-05-03 1997-12-23 Isis Innovation Limited Apparatus and method for analyzing polynucleotide sequences and method of generating oligonucleotide arrays
US5185243A (en) 1988-08-25 1993-02-09 Syntex (U.S.A.) Inc. Method for detection of specific nucleic acid sequences
AU629845B2 (en) 1988-08-30 1992-10-15 Abbott Laboratories Detection and amplification of target nucleic acid sequences
ATE157404T1 (en) 1989-03-17 1997-09-15 Abbott Lab METHOD AND DEVICE FOR HYBRIDIZING NUCLEIC ACID WITH IMPROVED REACTION KINETICS
AU5640090A (en) 1989-03-21 1990-11-05 Collaborative Research Inc. A dna diagnostic test using an exonuclease activity
US5035996A (en) * 1989-06-01 1991-07-30 Life Technologies, Inc. Process for controlling contamination of nucleic acid amplification reactions
US5424186A (en) * 1989-06-07 1995-06-13 Affymax Technologies N.V. Very large scale immobilized polymer synthesis
US5744101A (en) 1989-06-07 1998-04-28 Affymax Technologies N.V. Photolabile nucleoside protecting groups
US5143854A (en) 1989-06-07 1992-09-01 Affymax Technologies N.V. Large scale photolithographic solid phase synthesis of polypeptides and receptor binding screening thereof
US5527681A (en) 1989-06-07 1996-06-18 Affymax Technologies N.V. Immobilized molecular synthesis of systematically substituted compounds
US6040138A (en) 1995-09-15 2000-03-21 Affymetrix, Inc. Expression monitoring by hybridization to high density oligonucleotide arrays
GB8920097D0 (en) * 1989-09-06 1989-10-18 Ici Plc Amplification processes
US5104792A (en) * 1989-12-21 1992-04-14 The United States Of America As Represented By The Department Of Health And Human Services Method for amplifying unknown nucleic acid sequences
US5516663A (en) 1990-01-26 1996-05-14 Abbott Laboratories Ligase chain reaction with endonuclease IV correction and contamination control
CA2040896C (en) 1990-04-20 2002-01-29 Edwin F. Ullman Double receptor polynucleotide assay method
US5494810A (en) * 1990-05-03 1996-02-27 Cornell Research Foundation, Inc. Thermostable ligase-mediated DNA amplifications system for the detection of genetic disease
DK0528882T3 (en) 1990-05-03 2008-01-14 Cornell Res Foundation Inc DNA amplification system for detection of genetic diseases by thermostable ligase
DE69130800T2 (en) * 1990-07-24 1999-09-16 F. Hoffmann-La Roche Ag, Basel REDUCING NON-SPECIFIC AMPLIFICATION DURING AN (IN VITRO) NUCLEIC ACID AMPLIFICATION USING MODIFIED NUCLEIC ACID BASES
US5484699A (en) 1990-09-28 1996-01-16 Abbott Laboratories Nucleotide sequences useful as type specific probes, PCR primers and LCR probes for the amplification and detection of human papilloma virus, and related kits and methods
CA2046713A1 (en) * 1990-10-16 1992-04-17 Richard M. Martinelli Amplification of midivariant dna templates
US5700636A (en) 1990-10-19 1997-12-23 Becton Dickinson And Company Methods for selectively detecting microorganisms associated with vaginal infections in complex biological samples
CA2055755A1 (en) 1990-11-22 1992-05-23 Toshihiko Kishimoto Method of immobilizing single-stranded dna on carrier at terminal
EP0562047A4 (en) * 1990-12-06 1995-11-02 Affymax Tech Nv Sequencing by hybridization of a target nucleic acid to a matrix of defined oligonucleotides
DE4039348A1 (en) 1990-12-10 1992-06-11 Henkel Kgaa CARPET CLEANER
AU9178491A (en) 1990-12-13 1992-07-08 Board Of Regents, The University Of Texas System In-situ hybridization probes for identification and banding of specific human chromosomes and regions
EP0566670A4 (en) * 1990-12-17 1993-12-08 Idexx Laboratories, Inc. Nucleic acid sequence detection by triple helix formation
US5290925A (en) * 1990-12-20 1994-03-01 Abbott Laboratories Methods, kits, and reactive supports for 3' labeling of oligonucleotides
RU1794088C (en) * 1991-03-18 1993-02-07 Институт Молекулярной Биологии Ан@ Ссср Method of dna nucleotide sequence determination and a device for its realization
CA2109828A1 (en) * 1991-05-24 1992-11-26 President And Fellows Of Harvard College (The) Parallel sequential reactor
US5278298A (en) * 1991-05-29 1994-01-11 Merck & Co., Inc. Eimeria brunetti 16s rDNA probes
GB9112251D0 (en) 1991-06-07 1991-07-24 Amersham Int Plc Quantitative detection of nucleic acid amplification products
ES2091976T3 (en) * 1991-06-20 1996-11-16 Hoffmann La Roche PERFECTED METHODS FOR THE AMPLIFICATION OF NUCLEIC ACID.
US5371241A (en) * 1991-07-19 1994-12-06 Pharmacia P-L Biochemicals Inc. Fluorescein labelled phosphoramidites
WO1993004199A2 (en) 1991-08-20 1993-03-04 Scientific Generics Limited Methods of detecting or quantitating nucleic acids and of producing labelled immobilised nucleic acids
AU2872092A (en) 1991-10-15 1993-05-21 Multilyte Limited Binding assay employing labelled reagent
DE69232753T2 (en) 1991-11-01 2003-05-15 Diatech Pty. Ltd., Brisbane SOLIDS PHASE EXPANSION PROCESS
US5594121A (en) 1991-11-07 1997-01-14 Gilead Sciences, Inc. Enhanced triple-helix and double-helix formation with oligomers containing modified purines
US5324633A (en) * 1991-11-22 1994-06-28 Affymax Technologies N.V. Method and apparatus for measuring binding affinity
US5412087A (en) 1992-04-24 1995-05-02 Affymax Technologies N.V. Spatially-addressable immobilization of oligonucleotides and other biological polymers on surfaces
WO1993017126A1 (en) 1992-02-19 1993-09-02 The Public Health Research Institute Of The City Of New York, Inc. Novel oligonucleotide arrays and their use for sorting, isolating, sequencing, and manipulating nucleic acids
JPH07505293A (en) 1992-03-31 1995-06-15 アボツト・ラボラトリーズ Multiplex ligase chain reaction method
WO1993020236A1 (en) 1992-04-03 1993-10-14 Applied Biosystems, Inc. Probe composition and method
US5470705A (en) * 1992-04-03 1995-11-28 Applied Biosystems, Inc. Probe composition containing a binding domain and polymer chain and methods of use
JPH08503600A (en) 1992-05-29 1996-04-23 アボツト・ラボラトリーズ Ligase chain reaction initiated by RNA sequences
US5981176A (en) 1992-06-17 1999-11-09 City Of Hope Method of detecting and discriminating between nucleic acid sequences
EP0607151B1 (en) 1992-06-17 2002-11-13 City Of Hope A method of detecting and discriminating between nucleic acid sequences
WO1994001446A2 (en) 1992-07-09 1994-01-20 Beckman Instruments, Inc. Derivatized organic solid support for nucleic acid synthesis
GB9214873D0 (en) 1992-07-13 1992-08-26 Medical Res Council Process for categorising nucleotide sequence populations
EP0654093B1 (en) 1992-08-03 2001-01-03 Abbott Laboratories Detecting and amplifying target nucleic acids using exonucleolytic activity
US6180338B1 (en) 1992-08-04 2001-01-30 Beckman Coulter, Inc. Method, reagent and kit for the detection and amplification of nucleic acid sequences
WO1994006906A1 (en) 1992-09-18 1994-03-31 Merck & Co., Inc. DNA ENCODING MURINE PRECURSOR INTERLEUKIN 1β CONVERTING ENZYME
WO1994008047A1 (en) 1992-09-25 1994-04-14 Abbott Laboratories Ligase chain reaction method for detecting small mutations
WO1994009022A1 (en) * 1992-10-09 1994-04-28 Oncor, Inc. Methods for the detection of chromosome structural abnormalities by in situ hybridization to fixed tissue
US5795714A (en) * 1992-11-06 1998-08-18 Trustees Of Boston University Method for replicating an array of nucleic acid probes
JP2575270B2 (en) * 1992-11-10 1997-01-22 浜松ホトニクス株式会社 Method for determining base sequence of nucleic acid, method for detecting single molecule, apparatus therefor and method for preparing sample
US5605798A (en) 1993-01-07 1997-02-25 Sequenom, Inc. DNA diagnostic based on mass spectrometry
AU6027794A (en) 1993-01-15 1994-08-15 Public Health Research Institute Of The City Of New York, Inc., The Diagnostic assays and kits for rna using rna binary probes and an rna-directed rna ligase
JPH08505531A (en) 1993-01-15 1996-06-18 ザ パブリック ヘルス リサーチ インスティチュート オブ ザ シティー オブ ニューヨーク インク RNA assay method using RNA binary probe and ribozyme ligase
AU6031094A (en) 1993-01-15 1994-08-15 Public Health Research Institute Of The City Of New York, Inc., The Sensitive nucleic acid sandwich hybridization assays and kits
JPH08508636A (en) * 1993-01-27 1996-09-17 オンコール インコーポレーテッド Amplification of nucleic acid sequences
WO1994017206A1 (en) * 1993-01-27 1994-08-04 Oncor, Inc. Method for amplifying nucleic acid sequences
US5593840A (en) * 1993-01-27 1997-01-14 Oncor, Inc. Amplification of nucleic acid sequences
US5985548A (en) 1993-02-04 1999-11-16 E. I. Du Pont De Nemours And Company Amplification of assay reporters by nucleic acid replication
DE69413574T2 (en) * 1993-02-09 1999-05-12 Agfa-Gevaert N.V., Mortsel A processing solution and method for producing a lithographic offset printing plate by the silver salt diffusion transfer process
US5593826A (en) 1993-03-22 1997-01-14 Perkin-Elmer Corporation, Applied Biosystems, Inc. Enzymatic ligation of 3'amino-substituted oligonucleotides
US5422252A (en) * 1993-06-04 1995-06-06 Becton, Dickinson And Company Simultaneous amplification of multiple targets
CA2122203C (en) * 1993-05-11 2001-12-18 Melinda S. Fraiser Decontamination of nucleic acid amplification reactions
US6709813B1 (en) 1993-05-14 2004-03-23 Ortho-Clinical Diagnostics, Inc. Diagnostic compositions, elements, methods and test kits for amplification and detection of human CMV DNA using primers having matched melting temperatures
US5652106A (en) 1993-06-04 1997-07-29 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Rapid amplification-based subtyping of mycobacterium tuberculosis
DK72493D0 (en) 1993-06-18 1993-06-18 Risoe Forskningscenter SOLID SUPPORTS FOR USE IN PEPTIDE SYNTHESIS AND ASSAYS
US5837832A (en) 1993-06-25 1998-11-17 Affymetrix, Inc. Arrays of nucleic acid probes on biological chips
US5858659A (en) 1995-11-29 1999-01-12 Affymetrix, Inc. Polymorphism detection
US5731171A (en) * 1993-07-23 1998-03-24 Arch Development Corp. Sequence independent amplification of DNA
US5601978A (en) 1993-09-03 1997-02-11 Abbott Laboratories Oligonucleotides and methods for the detection of chlamydia trachomatis
US5415839A (en) 1993-10-21 1995-05-16 Abbott Laboratories Apparatus and method for amplifying and detecting target nucleic acids
US6156501A (en) 1993-10-26 2000-12-05 Affymetrix, Inc. Arrays of modified nucleic acid probes and methods of use
US5352582A (en) * 1993-10-28 1994-10-04 Hewlett-Packard Company Holographic based bio-assay
US5429807A (en) 1993-10-28 1995-07-04 Beckman Instruments, Inc. Method and apparatus for creating biopolymer arrays on a solid support surface
US5415087A (en) * 1994-01-21 1995-05-16 Norfolk Southern Railway Co. Mobile tie banding apparatus
US5631130A (en) 1994-05-13 1997-05-20 Abbott Laboratories Materials and methods for the detection of Mycobacterium tuberculosis
WO1995031571A2 (en) 1994-05-13 1995-11-23 Abbott Laboratories Materials and methods for the detection of mycobacteria
US5508168A (en) 1994-05-16 1996-04-16 Hoffmann-La Roche Inc. Methods and reagents for the detection of herpes simplex virus, treponema pallidum, and haemophilus ducreyi
US7378236B1 (en) 1994-06-17 2008-05-27 The Board Of Trustees Of The Leland Stanford Junior University Method for analyzing gene expression patterns
US5876924A (en) * 1994-06-22 1999-03-02 Mount Sinai School Of Medicine Nucleic acid amplification method hybridization signal amplification method (HSAM)
WO1995035390A1 (en) * 1994-06-22 1995-12-28 Mount Sinai School Of Medicine Of The City University Of New York Ligation-dependent amplification for the detection of infectious pathogens and abnormal genes
US5942391A (en) * 1994-06-22 1999-08-24 Mount Sinai School Of Medicine Nucleic acid amplification method: ramification-extension amplification method (RAM)
US5834181A (en) 1994-07-28 1998-11-10 Genzyme Corporation High throughput screening method for sequences or genetic alterations in nucleic acids
JP3102800B2 (en) * 1994-08-19 2000-10-23 パーキン−エルマー コーポレイション Conjugation methods for amplification and ligation
US5648213A (en) 1994-08-30 1997-07-15 Beckman Instruments, Inc. Compositions and methods for use in detection of analytes
US5604097A (en) 1994-10-13 1997-02-18 Spectragen, Inc. Methods for sorting polynucleotides using oligonucleotide tags
US5695934A (en) * 1994-10-13 1997-12-09 Lynx Therapeutics, Inc. Massively parallel sequencing of sorted polynucleotides
US5512441A (en) * 1994-11-15 1996-04-30 American Health Foundation Quantative method for early detection of mutant alleles and diagnostic kits for carrying out the method
WO1996015271A1 (en) * 1994-11-16 1996-05-23 Abbott Laboratories Multiplex ligations-dependent amplification
ES2294787T3 (en) 1995-06-05 2008-04-01 Biomerieux, Inc. DEVICE AND METHOD FOR DETECTING MICROORGANISMS.
US5667974A (en) 1995-06-07 1997-09-16 Abbott Laboratories Method for detecting nucleic acid sequences using competitive amplification
US5728526A (en) 1995-06-07 1998-03-17 Oncor, Inc. Method for analyzing a nucleotide sequence
WO1996041011A1 (en) 1995-06-07 1996-12-19 Lynx Therapeutics, Inc. Oligonucleotide tags for sorting and identification
US5723320A (en) 1995-08-29 1998-03-03 Dehlinger; Peter J. Position-addressable polynucleotide arrays
US5759779A (en) 1995-08-29 1998-06-02 Dehlinger; Peter J. Polynucleotide-array assay and methods
US5695937A (en) 1995-09-12 1997-12-09 The Johns Hopkins University School Of Medicine Method for serial analysis of gene expression
US5856096A (en) 1995-09-20 1999-01-05 Ctrc Research Foundation Rapid and sensitive assays for detecting and distinguishing between processive and non-processive telomerase activities
AU714486B2 (en) 1995-11-21 2000-01-06 Yale University Unimolecular segment amplification and detection
US5854033A (en) 1995-11-21 1998-12-29 Yale University Rolling circle replication reporter systems
EP0880598A4 (en) 1996-01-23 2005-02-23 Affymetrix Inc Nucleic acid analysis techniques
US6962263B2 (en) * 1996-01-24 2005-11-08 Sambrailo Packaging, Inc. Produce packaging system having produce containers with double-arched ventilation channels
US20020150921A1 (en) * 1996-02-09 2002-10-17 Francis Barany Detection of nucleic acid sequence differences using the ligase detection reaction with addressable arrays
EP2368897B1 (en) 1996-02-09 2016-10-19 Cornell Research Foundation, Inc. Detection of nucleic acid sequence differences using the ligase detection reaction with addressable arrays
US6852487B1 (en) * 1996-02-09 2005-02-08 Cornell Research Foundation, Inc. Detection of nucleic acid sequence differences using the ligase detection reaction with addressable arrays
US5868136A (en) 1996-02-20 1999-02-09 Axelgaard Manufacturing Co. Ltd. Medical electrode
EP1736554B1 (en) 1996-05-29 2013-10-09 Cornell Research Foundation, Inc. Detection of nucleic acid sequence differences using coupled ligase detection and polymerase chain reactions
US6312892B1 (en) 1996-07-19 2001-11-06 Cornell Research Foundation, Inc. High fidelity detection of nucleic acid differences by ligase detection reaction
JP2001512483A (en) 1997-02-25 2001-08-21 イーライ リリー アンド カンパニー Treatment of infertility with leptin receptor ligand
US6313048B1 (en) * 1997-03-03 2001-11-06 Micron Technology, Inc. Dilute cleaning composition and method for using same
US5932711A (en) 1997-03-05 1999-08-03 Mosaic Technologies, Inc. Nucleic acid-containing polymerizable complex
US6899889B1 (en) * 1998-11-06 2005-05-31 Neomend, Inc. Biocompatible material composition adaptable to diverse therapeutic indications
US7014994B1 (en) * 1999-03-19 2006-03-21 Cornell Research Foundation,Inc. Coupled polymerase chain reaction-restriction-endonuclease digestion-ligase detection reaction process
US6506594B1 (en) 1999-03-19 2003-01-14 Cornell Res Foundation Inc Detection of nucleic acid sequence differences using the ligase detection reaction with addressable arrays
JP2002539849A (en) 1999-03-26 2002-11-26 ホワイトヘッド インスチチュート フォアー バイオメディカル リサーチ Universal array
US20030207295A1 (en) 1999-04-20 2003-11-06 Kevin Gunderson Detection of nucleic acid reactions on bead arrays
DE60131903T2 (en) 2000-10-24 2008-11-27 The Board of Trustees of the Leland S. Stanford Junior University, Palo Alto DIRECT MULTIPLEX CHARACTERIZATION OF GENOMIC DNA

Also Published As

Publication number Publication date
US20030032016A1 (en) 2003-02-13
EP0912761A4 (en) 2004-06-09
US7429453B2 (en) 2008-09-30
US8597890B2 (en) 2013-12-03
WO1997045559A1 (en) 1997-12-04
AU3216097A (en) 1998-01-05
JP2008092959A (en) 2008-04-24
US6797470B2 (en) 2004-09-28
US7312039B2 (en) 2007-12-25
US8283121B2 (en) 2012-10-09
JP2011139718A (en) 2011-07-21
US7556924B2 (en) 2009-07-07
US7320865B2 (en) 2008-01-22
US8802373B2 (en) 2014-08-12
EP1736554A3 (en) 2007-02-21
US7332285B2 (en) 2008-02-19
US20070054306A1 (en) 2007-03-08
JP4781372B2 (en) 2011-09-28
US20080171330A1 (en) 2008-07-17
US20130224746A1 (en) 2013-08-29
US20100006437A1 (en) 2010-01-14
US20060024731A1 (en) 2006-02-02
US20040214224A1 (en) 2004-10-28
CA2255774A1 (en) 1997-12-04
CA2255774C (en) 2008-03-18
US20120270272A1 (en) 2012-10-25
US20040203061A1 (en) 2004-10-14
US8642269B2 (en) 2014-02-04
US20070054305A1 (en) 2007-03-08
US6268148B1 (en) 2001-07-31
US20070048783A1 (en) 2007-03-01
AU730633B2 (en) 2001-03-08
JP2000511060A (en) 2000-08-29
EP2369007A1 (en) 2011-09-28
US7166434B2 (en) 2007-01-23
US20120270220A1 (en) 2012-10-25
US20150018249A1 (en) 2015-01-15
EP1736554A2 (en) 2006-12-27
US8597891B2 (en) 2013-12-03
US6027889A (en) 2000-02-22
JP5634936B2 (en) 2014-12-03
EP2369007B1 (en) 2015-07-29
EP0912761A1 (en) 1999-05-06
US7097980B2 (en) 2006-08-29
JP4468488B2 (en) 2010-05-26
US7364858B2 (en) 2008-04-29
US20140315757A1 (en) 2014-10-23
US20070042419A1 (en) 2007-02-22
US20120252696A1 (en) 2012-10-04

Similar Documents

Publication Publication Date Title
EP1736554B1 (en) Detection of nucleic acid sequence differences using coupled ligase detection and polymerase chain reactions
WO1998003673A9 (en) High fidelity detection of nucleic acid differences by ligase detection reaction
ANG et al. FRONTIERS IN HUMAN GENETICS
ANG et al. A NOVEL METHOD OF GENOTYPING SINGLE NUCLEOTIDE POLYMORPHISMS (SNP) USING MELT CURVE ANALYSIS ON A CAPILLARY THERMOCYCLER

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20060622

AC Divisional application: reference to earlier application

Ref document number: 0912761

Country of ref document: EP

Kind code of ref document: P

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): CH DE FR GB IT LI SE

PUAL Search report despatched

Free format text: ORIGINAL CODE: 0009013

AK Designated contracting states

Kind code of ref document: A3

Designated state(s): CH DE FR GB IT LI SE

17Q First examination report despatched

Effective date: 20070413

AKX Designation fees paid

Designated state(s): CH DE FR GB IT LI SE

APBK Appeal reference recorded

Free format text: ORIGINAL CODE: EPIDOSNREFNE

APBN Date of receipt of notice of appeal recorded

Free format text: ORIGINAL CODE: EPIDOSNNOA2E

APBR Date of receipt of statement of grounds of appeal recorded

Free format text: ORIGINAL CODE: EPIDOSNNOA3E

APAF Appeal reference modified

Free format text: ORIGINAL CODE: EPIDOSCREFNE

APAF Appeal reference modified

Free format text: ORIGINAL CODE: EPIDOSCREFNE

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: CORNELL RESEARCH FOUNDATION, INC.

APBT Appeal procedure closed

Free format text: ORIGINAL CODE: EPIDOSNNOA9E

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

INTG Intention to grant announced

Effective date: 20130426

GRAS Grant fee paid

Free format text: ORIGINAL CODE: EPIDOSNIGR3

GRAA (expected) grant

Free format text: ORIGINAL CODE: 0009210

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: CORNELL RESEARCH FOUNDATION, INC.

RIN1 Information on inventor provided before grant (corrected)

Inventor name: BARANY, FRANCIS

Inventor name: LUBIN, MATTHEW

Inventor name: HAMMER, ROBERT P.

Inventor name: BELGRADER, PHILLIP

Inventor name: BARANY, GEORGE

AC Divisional application: reference to earlier application

Ref document number: 0912761

Country of ref document: EP

Kind code of ref document: P

AK Designated contracting states

Kind code of ref document: B1

Designated state(s): CH DE FR GB IT LI SE

REG Reference to a national code

Ref country code: GB

Ref legal event code: FG4D

REG Reference to a national code

Ref country code: CH

Ref legal event code: NV

Representative=s name: ISLER AND PEDRAZZINI AG, CH

Ref country code: CH

Ref legal event code: EP

REG Reference to a national code

Ref country code: DE

Ref legal event code: R096

Ref document number: 69740660

Country of ref document: DE

Effective date: 20131205

REG Reference to a national code

Ref country code: SE

Ref legal event code: TRGR

REG Reference to a national code

Ref country code: DE

Ref legal event code: R097

Ref document number: 69740660

Country of ref document: DE

PLBE No opposition filed within time limit

Free format text: ORIGINAL CODE: 0009261

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: NO OPPOSITION FILED WITHIN TIME LIMIT

26N No opposition filed

Effective date: 20140710

REG Reference to a national code

Ref country code: DE

Ref legal event code: R097

Ref document number: 69740660

Country of ref document: DE

Effective date: 20140710

REG Reference to a national code

Ref country code: FR

Ref legal event code: PLFP

Year of fee payment: 20

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: CH

Payment date: 20160527

Year of fee payment: 20

Ref country code: GB

Payment date: 20160527

Year of fee payment: 20

Ref country code: DE

Payment date: 20160527

Year of fee payment: 20

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: SE

Payment date: 20160527

Year of fee payment: 20

Ref country code: IT

Payment date: 20160520

Year of fee payment: 20

Ref country code: FR

Payment date: 20160530

Year of fee payment: 20

REG Reference to a national code

Ref country code: DE

Ref legal event code: R071

Ref document number: 69740660

Country of ref document: DE

REG Reference to a national code

Ref country code: CH

Ref legal event code: PL

REG Reference to a national code

Ref country code: GB

Ref legal event code: PE20

Expiry date: 20170526

REG Reference to a national code

Ref country code: SE

Ref legal event code: EUG

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: GB

Free format text: LAPSE BECAUSE OF EXPIRATION OF PROTECTION

Effective date: 20170526

OSZAR »