ES2382542T3 - Polynucleotides for use as labels and tag complements, manufacture and use thereof - Google Patents

Abstract

A family of minimally cross-hybridizing nucleotide sequences, methods of use, etc. A specific family of 1168 24mers is described.

Description

Polynucleotides for use as labels and tag complements, manufacture and use thereof.

Field of the Invention

The present invention relates to families of oligonucleotide tags for use, for example, in the classification of molecules. Members of a given family of tags can be distinguished from each other by specific hybridization with their tag add-ons.

Background of the invention

Specific hybridization of oligonucleotides and their analogs is a fundamental procedure that is used in a wide variety of medical and industrial research applications, including the identification of disease-related polynucleotides in diagnostic assays, examination to select novel target polynucleotide clones, identification of specific polynucleotides in transfers of polynucleotide mixtures, therapeutic blocking of inappropriately expressed genes and DNA sequencing. Sequence-specific hybridization is critical in the development of high performance multiplexed nucleic acid assays. As the formats for these assays expand to cover larger amounts of sequence information acquired through projects such as the human genome project, the challenge of sequence-specific hybridization with high fidelity becomes increasingly difficult to achieve.

In large part, the success of hybridization using oligonucleotides depends on minimizing the number of false positives and false negatives. Such problems have made the simultaneous use of multiple hybridization probes very difficult in a single experiment, that is multiplexing, particularly in the analysis of multiple gene sequences in a gene microalignment. For example, in certain binding assays, several nucleic acid molecules are attached to a chip in the hope that a given "target" sequence selectively binds to its complement bound to the chip. Approaches have been developed that involve the use of oligonucleotide tags attached to a solid support that can be used to specifically hybridize to tag complements that couple to probe sequences. Chetverin et al. (WO 93/17126) use binary oligonucleotide alignments, sectioned, to classify and analyze nucleic acids. These alignments have a constant nucleotide sequence linked to an adjacent variable nucleotide sequence, both linked to a solid support by a covalent binding moiety. These binary alignments have advantages compared to usual alignments because they can be used to classify chains according to their terminal sequences so that each chain joins a fixed location in an alignment. The design of the terminal sequences in this approach includes the use of constant and variable sequences. U.S. Patent Nos. 6,103,463 and 6,322,971 issued to Chetverin et al. on August 15, 2000 and November 27, 2001, respectively.

This concept of using molecular labels to classify a mixture of molecules is analogous to molecular labels developed for bacterial and yeast genetics (Hensel et al., Science; 269, 400-403: 1995 and Schoemaker et al., Nature Genetics; 14, 450-456: 1996). In this case, a procedure called "tagged" signature mutagenesis is used in which each mutant is labeled with a different DNA sequence to recover mutant genes from a complex mixture of approximately 10,000 bacterial colonies. In the labeling approach of Barany et al. (WO 9731256), known as the "postal chip", a family of nucleic acid molecules, the "postal code addresses", each different from the others, are displayed on a grid. Target molecules are attached to oligonucleotide sequences complementary to "postal code addresses", called "postal codes", which are used to specifically hybridize to address locations on the grid. Although the selection of these families of polynucleotide sequences used as addresses is critical for proper assay performance, the performance has not been described.

Working in a highly parallel hybridization environment that requires specific hybridization imposes many rigorous selection criteria for the design of oligonucleotide families to be used. The success of these approaches depends on the specific hybridization of a probe and its complement. Problems arise since the family of nucleic acid molecules cross-hybridize or incorrectly hybridize with the target sequences. Although it is common to obtain incorrect hybridization that results in false positives or an inability to form hybrids that results in false negatives, the frequency of such results should be minimized. To achieve this objective, certain thermodynamic properties of nucleic acid hybrid formation must be considered. The temperature at which the oligonucleotides form a duplex with their complementary sequences known as the Tm (the temperature at which 50% of the nucleic acid duplex is dissociated) varies according to several sequence dependent properties including bridging energies. hydrogen of the conventional AT and GC pairs (reflected in GC or base composition), stacking-free energy and, to a lesser extent, interactions between nearest neighbors. These energies vary widely between oligonucleotides that are normally used in hybridization assays. For example, the hybridization of two probe sequences composed of 24 nucleotides, one with a GC content of 40% and the other with a

GC content of 60%, with its complementary target under conventional conditions, can theoretically present a difference of 10 ° C in melting temperature (Mueller et al., Current Protocols in Mol. Biol .; 15, 5: 1993). Problems in hybridization occur when hybrids are allowed to form under hybridization conditions that include a single hybridization temperature that is not optimal for proper hybridization of all oligonucleotide sequences in a set. Mismatching hybridization of non-complementary probes may occur by forming a duplex with measurable mating stability (Santalucia et al., Biochemistry; 38: 3468-77, 1999). Duplex mismatch may occur in a particular set of oligonucleotides under hybridization conditions in which the mismatch results in a decrease in the stability of the duplex resulting in a Tf greater than the correct less stable duplex of that particular set. For example, if hybridization is carried out under conditions that favor the perfect mating duplex sequence rich in AT, there is the possibility of hybridization of a GC-rich duplex sequence containing a base with erroneous mating that has a temperature of fusion that is still superior to the duplex rich in AT formed correctly. Therefore, the design of families of oligonucleotide sequences that can be used in multiplexed hybridization reactions should include consideration of the thermodynamic properties of oligonucleotides and the formation of duplexes that will reduce or eliminate cross-hybridization behavior within the set of oligonucleotides designed. .

The development of such tag families over the years has been attempted with varying degrees of success. There are several different approaches to select sequences for use in multiplexed hybridization assays. The selection of sequences that can be used as postal codes or labels in an addressable alignment has been described in the patent literature in an approach adopted by Brenner et al. US Patent No. 5,654,413 describes a population of oligonucleotide tags (and corresponding tag complements) in which each oligonucleotide tag includes a plurality of subunits, each subunit consisting of an oligonucleotide having a length of from three to six nucleotides. and selecting each subunit of a set that has minimal cross hybridization, in which a subunit of the set will have at least two mismatches with any other sequence of the set. Table II of the Brenner patent specification describes exemplary groups of 4-mer subunits that exhibit minimal cross hybridization according to the criteria mentioned above. In the approach adopted by Brenner, the construction of oligonucleotides that do not exhibit cross hybridization is based on the use of subunits that form a duplex that has at least two mismatches with the complement of any other subunit of the same set. The ordering of subunits in the construction of oligonucleotide tags is not specifically defined.

The parameters used in label design based on subunits are discussed in Barany et al. (WO 9731256). For example, in the design of polynucleotide sequences that have, for example, 24 nucleotides in length (24 groupers) derived from a set of four possible tetramers in which each 24-meter "address" differs from its nearest 24-mer neighbor. in 3 tetramers. They further comment that, if each tetramer differs from the others by at least two nucleotides, then every 24 numbers will differ from the following by at least six nucleotides. This is determined without regard to the insertions or deletions when the alignment between any two sequences in the set is formed. In this way a unique “zip code” sequence is generated. The postal code is attached to a marker in a target dependent manner, resulting in a unique "postal code" that is then allowed to hybridize with its address on the chip. To minimize cross-hybridization of a "zip code" to other "addresses", the hybridization reaction is carried out at temperatures of 75-80 ° C. Due to the high temperature conditions for hybridization, 24 groupers that have partial homology hybridize to a lesser extent than sequences with perfect complementarity and represent “dead zones”. This approach of implementing rigorous hybridization conditions for example, which involve high temperature hybridization, is also implemented by Brenner et al.

The current state of the art for designing labels that do not exhibit cross hybridization based on subunits does not provide sufficient guidelines to construct a family of relatively large numbers of sequences with practical value in assays that require behavior that does not exhibit rigorous cross hybridization.

A multiplex sequencing procedure has been described in US Patent No. 4,942,124, which was granted to Church on July 17, 1990. The procedure requires at least two vectors that differ from each other in a tag sequence. It is mentioned that a tag sequence in one vector will not hybridize under stringent hybridization conditions with a tag sequence (i.e., the complementary probes do not cross hybridize) in another vector. Rigorous hybridization conditions are provided by way of example as 42 ° C in 500-1000 mM sodium phosphate buffer. A set of 42 20-meter label sequences is provided in Figure 3 of the specification, all of which lack G residues. No details are provided on how the sequences were obtained, although Church mentions that 92 were initially chosen based on 92. in that they presented enough sequence diversity to guarantee their uniqueness.

Therefore, although it is possible for a person skilled in the art to design a small number of labels that do not exhibit cross hybridization, it is difficult to design a large number of such labels. A pending application along with

The present of the owner of this patent application describes such a set of 210 labels that do not have cross hybridization that have a practical value. A procedure is described in International Patent Application No. PCT / CA 01/00141 published as WO 01/59151 on August 16, 2001. However, few guidelines are provided to provide a larger assembly, for example approximately 1000, labels that do not have cross hybridization. Since having sets of approximately 1000 labels that do not have cross hybridization, or more, would have considerable practical value, it would be useful to develop such a set.

Therefore, although it is desirable with such alignments to have, at the same time, a large number of address molecules, the address molecules must each be highly selective for their own complement sequence. Although such an alignment provides the advantage that the family of molecules constituting the grid is completely designed, and not based on sequences as they occur in nature, providing a family of molecules, which is large enough and in that each individual member is sufficiently selective for its complement with respect to all other zip code molecules (ie, in which there is cross-talk hybridization, or interference ("cross-talk"), low enough) continues to elude researchers .

Summary of Invention

A family of 1168 sequences was obtained using a computer algorithm to present desirable hybridization properties for use in nucleic acid detection assays. The 1168 oligonucleotide sequence set was partially characterized in hybridization assays, demonstrating the ability of family members to properly hybridize with their complementary sequences with minimal cross hybridization. These are the sequences that have SEQ ID NO: 1 to 1168 of table I.

The variant families of sequences (considered labels or tag complements) of a family of sequences taken from Table I are also part of the invention. For evaluation purposes, a family or set of oligonucleotides will often be described as a family of tag complements, but it will be understood that such a set can easily be a family of tags.

A family of complements is obtained from an oligonucleotide set based on a family of oligonucleotides such as those in Table I. To simplify the evaluation, it will be described to provide a family of complements based on the oligonucleotides in Table I.

First, the sequence groups based on the oligonucleotides in Table I can be represented as shown in Table IA.

Table IA: Numerical sequences that correspond to nucleotide base patterns of an oligonucleotide set

Identifier of

Numerical pattern

sequence

Table IA: Numerical sequences that correspond to nucleotide base patterns of an oligonucleotide set

Numerical pattern

Table IA: Numerical sequences that correspond to nucleotide base patterns of an oligonucleotide set

Numerical pattern

Table IA: Numerical sequences that correspond to nucleotide base patterns of an oligonucleotide set

Numerical pattern

Table IA: Numerical sequences that correspond to nucleotide base patterns of an oligonucleotide set

Numerical pattern

Table IA: Numerical sequences that correspond to nucleotide base patterns of an oligonucleotide set

Numerical pattern

Table IA: Numerical sequences that correspond to nucleotide base patterns of an oligonucleotide set

Numerical pattern

Table IA: Numerical sequences that correspond to nucleotide base patterns of an oligonucleotide set

Numerical pattern

Table IA: Numerical sequences that correspond to nucleotide base patterns of an oligonucleotide set

Numerical pattern

Table IA: Numerical sequences that correspond to nucleotide base patterns of an oligonucleotide set

Numerical pattern

Table IA: Numerical sequences that correspond to nucleotide base patterns of an oligonucleotide set

Numerical pattern

Table IA: Numerical sequences that correspond to nucleotide base patterns of an oligonucleotide set

Numerical pattern

Table IA: Numerical sequences that correspond to nucleotide base patterns of an oligonucleotide set

Numerical pattern

Table IA: Numerical sequences that correspond to nucleotide base patterns of an oligonucleotide set

Numerical pattern

Table IA: Numerical sequences that correspond to nucleotide base patterns of an oligonucleotide set

Numerical pattern

Table IA: Numerical sequences that correspond to nucleotide base patterns of an oligonucleotide set

Numerical pattern

Table IA: Numerical sequences that correspond to nucleotide base patterns of an oligonucleotide set

Numerical pattern

Table IA: Numerical sequences that correspond to nucleotide base patterns of an oligonucleotide set

Numerical pattern

Table IA: Numerical sequences that correspond to nucleotide base patterns of an oligonucleotide set

Numerical pattern

Table IA: Numerical sequences that correspond to nucleotide base patterns of an oligonucleotide set

Numerical pattern

Table IA: Numerical sequences that correspond to nucleotide base patterns of an oligonucleotide set

Numerical pattern

Table IA: Numerical sequences that correspond to nucleotide base patterns of an oligonucleotide set

Identifier of

Numerical pattern

sequence

In Table IA, each of the numbers 1 to 3 (numerical identifiers) represents a nucleotide base and the pattern of numbers 1 to 3 of the sequences in the above list corresponds to the pattern of nucleotide bases present in the oligonucleotides of table I, oligonucleotides that have been found to have no hybridization

5, as further described in the detailed examples. Each nucleotide base is selected from the group of nucleotide bases consisting of A, C, G and T / U. A particularly preferred embodiment of the invention, in which a specific basis is assigned to each numerical identifier, is shown in Table I, below.

In a broad aspect, the invention is a composition comprising molecules for use as labels.

or tag complements in which each molecule comprises an oligonucleotide selected from a set of oligonucleotides based on a group of sequences as specified by numerical identifiers set forth in Table IA. In the sequences, each of 1 to 3 is a nucleotide base selected to be different from the others of 1 to 3 with the proviso that up to three nucleotide bases of each sequence can

15 be replaced by any nucleotide base provided that:

for any pair of sequences in the set:

M1 � 16, M2 � 13 M3 � 20, M4 � 16, and M5 � 19, in which:

20 M1 is the maximum number of pairings for any alignment where there are no internal indels;

M2 is the maximum length of a mating block for any alignment;

M3 is the maximum number of pairings for any alignment that has a maximum score;

M4 is the maximum sum of the lengths of the two longest mating blocks for any alignment 5 of maximum score; Y

M5 is the maximum sum of the lengths of all the mating blocks that have a length of at least 3, for any maximum score alignment;

10 in which:

the score of an alignment is determined according to equation (A x m) - (B x mm) - (C x (og + eg)) - (D x eg)), in which:

15 for each of (i) to (iv):

(i)

 m = 6, mm = 6, og = 0 and eg = 6,

(ii)

 m = 6, mm = 6, og = 5 and eg = 1,

(iii) m = 6, mm = 2, og = 5 and eg = 1, and 20 (iv) m = 6, mm = 6, og = 6 and eg = 0,

A is the total number of paired base pairs in the alignment; B is the total number of mismatched pairs internally in the alignment; C is the total number of internal gaps in the alignment; Y

25 D is the total number of internal indels in the alignment minus the total number of internal gaps in the alignment; Y

in which the maximum score is determined separately for each of (i), (ii), (iii) and (iv).

30 In the section describing detailed embodiments, an explanation of the meanings of the parameters set forth above is provided.

In another broad aspect, the invention is a composition containing molecules for use as labels.

or tag supplements in which each molecule comprises an oligonucleotide selected from a set of

Oligonucleotides based on a group of sequences as set forth in Table IA in which each of 1 to 3 is a nucleotide base selected to be different from the others of 1 to 3 with the proviso that up to three bases of The nucleotide of each sequence can be substituted by any nucleotide base provided that:

for any pair of sequences in the set: 40 M1 19, M2 17, M3 21, M4 18, and M5 20, in which:

M1 is the maximum number of pairings for any alignment where there are no internal indels;

45 M2 is the maximum length of a mating block for any alignment;

M3 is the maximum number of pairings for any alignment that has a maximum score;

M4 is the maximum sum of the lengths of the two longest mating blocks for any alignment 50 of maximum score; Y

M5 is the maximum sum of the lengths of all the mating blocks that have a length of at least 3, for any maximum score alignment;

55 in which

the score of an alignment is determined according to equation (A x m) - (B x mm) - (C x (og + eg)) - (D x eg)), in which:

60 for each of (i) to (iv):

(i)

 m = 6, mm = 6, og = 0 and eg = 6,

(ii)

 m = 6, mm = 6, og = 5 and eg = 1,

(iii) m = 6, mm = 2, og = 5 and eg = 1, and 65 (iv) m = 6, mm = 6, og = 6 and eg = 0,

A is the total number of paired base pairs in the alignment; B is the total number of mismatched pairs internally in the alignment; C is the total number of internal gaps in the alignment; Y D is the total number of internal indels in the alignment minus the total number of internal gaps in the

alignments; Y in which the maximum score is determined separately for each of (i), (ii), (iii) and (iv). In another broad aspect, the invention is a composition comprising molecules for use as

tags or tag complement in which each molecule comprises an oligonucleotide selected from a set of oligonucleotides based on a group of sequences set forth in Table IA in which each 1 to 3 is a nucleotide base selected to be different from those others from 1 to 3 with the proviso that up to three nucleotide bases of each sequence can be substituted by any nucleotide base provided that:

for any pair of sequences in the set: M1 19, M2 17, M3 21, M4 18, and M5 20, in which: M1 is the maximum number of pairings for any alignment where there are no internal indels; M2 is the maximum length of a mating block for any alignment; M3 is the maximum number of pairings for any alignment that has a maximum score; M4 is the maximum sum of the lengths of the two longest mating blocks for any alignment

maximum score; Y

M5 is the maximum sum of the lengths of all the mating blocks that have a length of at minus 3, for any maximum score alignment, in which: the score of an alignment is determined according to equation 3A - B - 3C - D, in which: A is the total number of paired base pairs in the alignment; B is the total number of mismatched pairs internally in the alignment; C is the total number of internal gaps in the alignment; Y D is the total number of internal indels in the alignment minus the total number of internal gaps in the alignment. In preferred aspects, the invention provides a composition in which, for the sequence group of 24

numbers in which 1 = A, 2 = T and 3 = G, in a defined set of conditions in which the maximum degree of hybridization between a sequence and any complement of a different sequence of the 24-group sequence does not exceed 30% of the degree of hybridization between said sequence and its complement, for all of said oligonucleotides of the composition, the maximum degree of hybridization between an oligonucleotide and a complement of any other oligonucleotide of the composition does not exceed 50% of the degree of hybridization of the composition. oligonucleotide and its complement.

More preferably, the maximum degree of hybridization between a sequence and any complement of a different sequence does not exceed 30% of the degree of hybridization between said sequence and its complement, the degree of hybridization between each sequence and its complement varies by a factor of between 1 and up to 10, more preferably between 1 and up to 9, more preferably between 1 and up to 8, more preferably between 1 and up to 7, more preferably between 1 and up to 6, and more preferably between 1 and up to 5.

It is also preferred that the maximum degree of hybridization between a sequence and any complement of a different sequence does not exceed 25%, more preferably does not exceed 20%, more preferably does not exceed 15%, more preferably does not exceed 10%, more preferably it does not exceed 5%.

Even more preferably, the defined set referred to above of conditions results in a level of hybridization that is the same as the level of hybridization obtained when hybridization conditions include 0.2 M NaCl, 0.1 M Tris, 0.08% Triton X-100, pH 8.0 at 37 ° C.

In the composition, the defined set of conditions may include that the 24-group sequence group be

covalently bonded to pearls.

In a particular preferred aspect, for the group of 24 numbers the maximum degree of hybridization between a sequence and any complement of a different sequence does not exceed 15% of the degree of hybridization between said sequence and its complement and the degree of hybridization between each sequence. and its complement varies by a factor of 1 to 9, and for all oligonucleotides in the set, the maximum degree of hybridization between an oligonucleotide and a complement of any other oligonucleotide in the set does not exceed 20% of the degree of hybridization of the oligonucleotide and its complement.

It is possible that each 1 is one of A, T / U, G and C; every 2 is one of A, T / U, G and C; and every 3 is one of A, T / U, G and C; and each of 1, 2 and 3 is selected to be different from all the others of 1, 2 and 3. More preferably, 1 is A or T / U, 2 is A or T / U and 3 is G or C. Even more preferably, 1 is A, 2 is T / U, and 3 is G.

In a certain preferred composition, each of the oligonucleotides is from twenty-two to twenty-six bases in length, or from twenty-three to twenty-five, and preferably, each oligonucleotide is the same length as all the others of said oligonucleotides.

In a particularly preferred embodiment, each oligonucleotide is twenty-four bases in length.

It is preferred that no oligonucleotide contain more than four contiguous bases that are identical to each other.

It is also preferred that the number of G in each oligonucleotide does not exceed L / 4 in which L is the number of bases in said sequence.

For reasons described below, it is preferred that the number of G in each of said oligonucleotides does not vary from the average number of G in all oligonucleotides in more than one. Even more preferably, the number of G in each of said oligonucleotides is the same as in all other of said oligonucleotides. In the embodiment disclosed below in which oligonucleotides were tested, the sequence of each was twenty-four bases in length and each oligonucleotide contained 6 G.

It is also preferred that, for each nucleotide, there are a maximum of six different bases of G between each pair of neighboring pairs of G.

Furthermore, it is preferred that, at the 5 'end of each oligonucleotide at least one of the first, second, third, fourth, fifth, sixth and seventh bases of the oligonucleotide sequence is a G. Similarly, it is preferred that in the 3 'end of each oligonucleotide at least one of the first, second, third, fourth, fifth, sixth and seventh bases of the oligonucleotide sequence is a G.

It is possible to have sequence compositions that include one hundred and sixty of said molecules, or that include one hundred and seventy of said molecules, or that include one hundred and eighty of said molecules, or that include one hundred and ninety of said molecules, or that include two hundred of said molecules, or that include two hundred and twenty of said molecules, or that include two hundred and forty of said molecules, or that include two hundred and sixty of said molecules, or that include two hundred and eighty of said molecules, or that include three hundred of said molecules, or that include four hundred of said molecules molecules, or that include five hundred of said molecules,

or that they include six hundred of said molecules, or that they include seven hundred of said molecules, or that they include eight hundred of said molecules, or that they include nine hundred of said molecules, or that they include thousand of said molecules.

It is possible, in certain applications, that each molecule be bound to a solid phase support so that it can be distinguished from a mixture containing other of the molecules by hybridization with its complement. A molecule of this type can be attached to a defined location on a solid phase support such that the location defined for each molecule is different from the location defined for different molecules.

In certain embodiments, each solid phase support is a microparticle and each of said molecules covalently binds to a different microparticle of each of said other different molecules.

In another broad aspect, the invention is a composition comprising a set of 150 molecules for use as labels or tag complements in which each molecule includes an oligonucleotide having a sequence of at least sixteen nucleotide bases in which for any pair of set sequences:

M1 19/24 x L1, M2 17/24 x L1, M3 21/24 x L1, M4 18/24 x L1, M5 20/24 x L1, in which L1 is the length of the shortest sequence of the pair, in which:

M1 is the maximum number of pairings for any alignment of the sequence pair in which there are no internal indels;

M2 is the maximum length of a matching block for any sequence pair alignment;

M3 is the maximum number of pairings for any alignment of the sequence pair that has a maximum score; M4 is the maximum sum of the lengths of the two longest mating blocks for any alignment

of the pair of maximum scoring sequences; Y

M5 is the maximum sum of the lengths of all the matching blocks that have a length of at least 3, for any alignment of the pair of maximum scoring sequences, in which: the score of an alignment is determined according to equation (A xm) - (B x mm) - (C x (og + eg)) - (D x eg)), in the

that: for each one of (i) to (iv):

(i)

 m = 6, mm = 6, og = 0 and eg = 6,

(ii)

 m = 6, mm = 6, og = 5 and eg = 1,

(iii) m = 6, mm = 2, og a 5 and eg = 1, and

(iv) m = 6, mm = 6, og = 6 and eg = 0, A is the total number of paired base pairs in the alignment; B is the total number of mismatched pairs internally in the alignment; C is the total number of internal gaps in the alignment; Y D is the total number of internal indels in the alignment minus the total number of internal gaps in the alignment;

and in which the maximum score is determined separately for each of (i), (ii), (iii) and (iv). In yet another broad aspect, the invention is a composition that includes a set of 150 molecules for its

use as labels or tag complements in which each molecule has an oligonucleotide that has a sequence of at least sixteen nucleotide bases in which for any pair of sequences in the set:

M1 19, M2 17, M3 21, M4 18, and M5 20, in which:

M1 is the maximum number of pairings for any alignment of the sequence pair in which there is no internal indels; M2 is the maximum length of a matching block for any sequence pair alignment; M3 is the maximum number of pairings for any alignment of the sequence pair that has a

maximum score;

M4 is the maximum sum of the lengths of the two longest mating blocks for any alignment of the pair of maximum scoring sequences; Y M5 is the maximum sum of the lengths of all the mating blocks that have a length of at

minus 3, for any alignment of the pair of maximum scoring sequences, in which: the score of said alignment is determined according to equation 3A - B - 3C - D, in which: A is the total number of paired base pairs in the alignment; B is the total number of mismatched pairs internally in the alignment; C is the total number of internal gaps in the alignment; Y D is the total number of internal indels in the alignment minus the total number of internal gaps in the alignment. In certain embodiments of the invention, each sequence has between eighteen and thirty bases of

length, or between twenty and twenty-eight bases in length, or between twenty-one and twenty-seven bases in length, or between

twenty-two and twenty-six bases in length.

Frequently, each sequence has the same length as each of the other sequences. In particular embodiments disclosed herein, each sequence has twenty-four bases of 5 length.

Again, no sequence contains more than four contiguous bases that are identical to each other, etc., as described above.

The composition is such that, under a defined set of conditions, the maximum degree of hybridization between an oligonucleotide and any complement of an oligonucleotide other than the composition does not exceed approximately 30% of the degree of hybridization between said oligonucleotide and its complement , more preferably 20%, more preferably 15%, more preferably 10%, more preferably 6%.

The set of conditions results in a level of hybridization that is the same as the level of hybridization obtained when the hybridization conditions include 0.2 M NaCl, 0.1 M Tris, 0.08% Triton X-100, pH 8.0 at 37 ° C, and preferably the oligonucleotides are covalently bound to microparticles. Obviously, it is possible that these specific conditions are used to determine the level of hybridization.

It is also preferred that in such a defined set of conditions, the degree of hybridization between each oligonucleotide and its complement varies by a factor between 1 and up to 8, more preferably up to 7, more preferably up to 6, more preferably up to 5. In a Particular embodiment disclosed, the variance observed in the degree of hybridization was a factor of only 5.3, that is, the degree of hybridization between each oligonucleotide and its complement varied by a factor of between 1 and 5.6.

In certain preferred embodiments, in the defined set of conditions, the maximum degree of hybridization between one of said oligonucleotides and any complement of an oligonucleotide other than the composition does not exceed about 15%, more preferably 10%, more preferably 6%

In a preferred embodiment, the set of conditions results in a level of hybridization that is the same as the level of hybridization obtained when the hybridization conditions include 0.2 M NaCl, 0.1 M Tris, Triton X- 0.08% 100, pH 8.0 at 37 ° C, and the oligonucleotides are covalently bound to microparticles.

Furthermore, in the defined set of conditions, it is preferred that the degree of hybridization between each oligonucleotide and

Its complement varies by a factor of between 1 and up to 8, more preferably up to 7, more preferably up to 6, more preferably up to 5.

Any composition of the invention may include one hundred and sixty of the oligonucleotide molecules, or one hundred and seventy of the oligonucleotide molecules, or one hundred and eighty of the oligonucleotide molecules, or one hundred and ninety

40 of the oligonucleotide molecules, or two hundred of the oligonucleotide molecules, or two hundred and twenty of the oligonucleotide molecules, or two hundred and forty of the oligonucleotide molecules, or two hundred and sixty of the oligonucleotide molecules, or two hundred and eighty of the oligonucleotide molecules , or three hundred of the oligonucleotide molecules, or four hundred of the oligonucleotide molecules, or five hundred of the oligonucleotide molecules, or six hundred of the oligonucleotide molecules, or seven hundred of the oligonucleotide molecules,

45 or eight hundred of the oligonucleotide molecules, or nine hundred of the oligonucleotide molecules, or one thousand or more of the oligonucleotide molecules.

A composition of the invention can be a family of tags, or it can be a family of tag add-ons.

An oligonucleotide molecule belonging to a family of molecules of the invention may have one or more nucleotide base analogs incorporated therein, those that undergo normal Watson-Crick base pairing are preferable.

The invention includes kits for classifying and identifying polynucleotides. Such a kit may include one or more solid phase supports each having one or more spatially differentiated regions, each of these regions having a uniform population of substantially identical label complements covalently attached. Label complements are constituted by a set of oligonucleotides of the invention.

The one or more solid phase supports can be a flat substrate in which the one or more spatially differentiated regions is a plurality of spatially addressable regions.

Label complements can also be coupled to microparticles. The microparticles preferably each have a diameter in the range of from 5 to 40 μm.

Such a kit preferably includes microparticles that are spectrophotometrically unique, and therefore can be distinguished from each other according to conventional laboratory techniques. Obviously, for such kits to work, each type of microparticle will generally have only one label complement associated therewith, and there will usually be a different oligonucleotide label complement associated with (attached to) each type of microparticle.

The invention includes methods of using oligonucleotide families of the invention.

One such procedure is to analyze a biological sample that contains a biological sequence to determine the presence of a mutation or polymorphism in a nucleic acid locus. The procedure includes:

(TO)

amplifying the nucleic acid molecule in the presence of a first primer that has a 5 'sequence that presents the sequence of a tag complementary to the sequence of a tag complement belonging to a family of tag complements of the invention to form a molecule amplified with a 5 'end with a sequence complementary to the tag sequence;

(B)

extending the amplified molecule in the presence of a polymerase and a second primer having a 5 'end complementary to the 3' end of the amplified sequence, extending the 3 'end of the second primer to immediately adjacent to said locus, in the presence of a plurality of nucleoside triphosphate derivatives each of which: (i) can be incorporated during transcription by polymerase at the 3 'end of a growing nucleotide chain; (ii) causes the termination of the polymerization; and (iii) it can be detected differentially, with one another, in which there is one of said derivatives complementary to each possible nucleotide present in said locus of the amplified sequence;

(C)

specifically hybridize the second primer with a tag complement that has the tag complement sequence of (A); Y

(D)

detect the nucleotide derivative incorporated in the second primer in (B) to identify the base located in the nucleic acid locus.

In another method of the invention, a biological sample containing a plurality of nucleic acid molecules is analyzed to determine the presence of a mutation or polymorphism in a locus of each nucleic acid molecule, for each nucleic acid molecule. This procedure includes the following stages:

(TO)

amplifying the nucleic acid molecule in the presence of a first primer that has a 5 'sequence that presents the sequence of a tag complementary to the sequence of a tag complement belonging to a family of tag complements of the invention to form a molecule amplified with a 5 'end with a sequence complementary to the tag sequence;

(B)

extending the amplified molecule in the presence of a polymerase and a second primer having a 5 'end complementary to the 3' end of the amplified sequence, extending the 3 'end of the second primer to immediately adjacent to said locus, in the presence of a plurality of nucleoside triphosphate derivatives each of which: (i) can be incorporated during transcription by polymerase at the 3 'end of a growing nucleotide chain; (ii) causes the termination of the polymerization; and (iii) it can be detected differentially, with each other, in which there is one of said derivatives complementary to each possible nucleotide present in said locus of the amplified molecule;

(C)

specifically hybridize the second primer with a tag complement that has the tag complement sequence of (A); Y

(D)

detect the nucleotide derivative incorporated in the second primer in (B) to identify the base located in the nucleic acid locus;

wherein each label of (A) is unique to each nucleic acid molecule and steps (A) and (B) are carried out with said nucleic molecules in the presence of another.

Another method includes analyzing a biological sample that contains a plurality of complementary double-stranded nucleic acid molecules to determine the presence of a mutation or polymorphism in a locus of each nucleic acid molecule, for each nucleic acid molecule. The procedure includes the steps of:

(TO)

amplifying the double stranded molecule in the presence of a pair of first primers, each primer presenting an identical 5 'sequence presenting the sequence of a tag complementary to the sequence of a tag complement belonging to a family of tag complements of the invention to form amplified molecules with 5 'ends with a sequence complementary to the tag sequence;

(B)

extend the amplified molecules in the presence of a polymerase and a couple of second primers

each second primer presenting a 5 'end complementary to the 3' end of the amplified sequence, the 3 'end of each of said second primers extending to immediately adjacent to said locus, in the presence of a plurality of nucleoside triphosphate derivatives each of which: (i) may be incorporated during transcription by polymerase at the 3 'end of a chain of

5 growing nucleotides; (ii) causes the termination of the polymerization; and (iii) can be detected differentially, with each other;

(C)

specifically hybridize each of the second primers with a tag complement that has the tag complement sequence of (A); Y

(D)

detecting the nucleotide derivative incorporated in the second primers in (B) to identify the base located in said locus;

wherein the sequence of each label of (A) is unique for each nucleic acid molecule and steps (A) and (B) 15 are carried out with said nucleic molecules one in the presence of another.

In yet another aspect, the invention is a method of analyzing a biological sample that contains a plurality of nucleic acid molecules to determine the presence of a mutation or polymorphism in a locus of each nucleic acid molecule, for each nucleic acid molecule. , including the procedure the stages of:

(a) hybridize the molecule and a primer, the primer presenting a 5 'sequence presenting the sequence of a tag complementary to the sequence of a tag complement belonging to a family of tag complements of the invention and an end 3 'extending to immediately adjacent to the

25 locus;

(b)

enzymatically extending the 3 ′ end of the primer in the presence of a plurality of nucleoside triphosphate derivatives each of which: (i) can be enzymatically incorporated into the 3 ′ end of a growing nucleotide chain; (ii) causes the termination of said extension; and (iii) it can be detected differentially, with one another, in which there is one of said derivatives complementary to each possible nucleotide present in said locus;

(C)

specifically hybridize the extended primer formed in step (b) with a tag complement that

presents the tag complement sequence of (a); and 35

(d) detecting the nucleotide derivative incorporated in the primer in step (b) to identify the base located at the locus of the nucleic acid molecule;

wherein each label of (a) is unique to each nucleic acid molecule and steps (a) and (b) are carried out with said nucleic molecules in the presence of another.

The derivative can be a dideoxy nucleoside triphosphate.

Each respective complement can be linked as a uniform population of substantially identical complements in spatially differentiated regions on one or more solid phase supports.

Each label complement may include a label, each such label being different for respective complements, and step (d) may include detecting the presence of different markers for respective hybridization complexes of linked labels and label complements.

Another aspect of the invention includes a method of determining the presence of a target that is suspected of being contained in a mixture. The procedure includes the steps of:

(i) mark the target with a first marker; 55

(ii) provide a first detection moiety that can specifically bind to the target and that includes a first tag;

(iii) exposing a sample of the mixture to the detection residue under conditions suitable to allow (or cause) said specific binding of the molecule and the target;

(iv) provide a family of tag complements of the invention in which the family contains a first tag compliment that has a sequence complementary to that of the first tag;

65 (v) expose the sample to the family of label complements under appropriate conditions to allow (or cause) the specific hybridization of the first label and its label complement;

(vi) determining whether said first detection residue hybridized to a first said label complement is attached to a said labeled target to determine the presence or absence of said target in the mixture.

Preferably, the first tag complement is attached to a solid support at a specific location of the support and step (vi) includes detecting the presence of the first marker at said specific location.

In addition, the first tag complement may include a second marker and step (vi) includes detecting the presence of the first and second markers in a hybrid complex of the rest and the first complement of

10 label

In addition, the target can be selected from the group consisting of organic molecules, antigens, proteins, polypeptides, antibodies and nucleic acids. The target can be an antigen and the first molecule can be a specific antibody for that antigen.

The antigen is usually a polypeptide or a protein and the labeling step may include the conjugation of fluorescent molecules, digoxigenin, biotinylation and the like.

The target may be a nucleic acid and the labeling step may include the incorporation of fluorescent molecules, radiolabeled nucleotide, digoxigenin, biotinylation and the like.

Detailed description of the invention

Figures

25 Reference is made to the attached figures, in which

Figure 1 generally illustrates the steps taken to obtain a family of sequences of the present invention;

Figure 2 shows the signal strength (MFI) for each perfect pairing sequence (probe sequences indicated in Table I) and its complement (target, at 50 fmol) obtained as described in example 1;

Figure 3 is a three-dimensional representation showing cross hybridization observed for the sequences of

Figure 2 as described in Example 1. The results shown in Figure 2 are reproduced along the diagonal of the drawing; Y

Figure 4 is illustrative of the results obtained for an individual target (SEQ ID NO: 90, target No. 90) when exposed to the 100 probes of Example 1. The MFI is plotted for each bead.

40 Detailed embodiments

The invention provides a method for classifying complex mixtures of molecules by utilizing families of oligonucleotide sequence tags. The families of oligonucleotide sequence tags

45 are designed so as to provide minimal cross hybridization during the classification process. Therefore, any sequence within a family of sequences will not exhibit cross hybridization significantly with any other sequence derived from that family under appropriate hybridization conditions known to those skilled in the art. The invention is particularly useful in the highly parallel processing of analytes.

50 families of oligonucleotide sequence tags

The present invention includes a family of 24 grouper polynucleotides that have been shown to exhibit minimal cross hybridization with each other. This family of polynucleotides is, therefore, useful as a family of labels, and their complements as label complements.

55 In order to be considered for inclusion in the family, a sequence had to satisfy a certain number of rules regarding its composition. For example, repeat regions that exhibit possible hybridization problems such as four or more of a similar base (for example, AAAA or TTTT) or pairs of G were prohibited. Another rule is that each sequence contains exactly six G and no C , in order to present

60 sequences that are more or less isothermal. It is also required to include a 24-mer molecule that is at most six bases between each neighboring pair of G. Another way of expressing this is that there are at most six different bases to G between any two consecutive G. In addition, it was required that each G closest to the 5 'end (resp. The 3' end) of its oligonucleotide (the left side (resp. The right side) as written in Table I) occupy one of the first seven positions (counting the 5'-terminal position (resp. 3 '

65 terminal) as the first.)

The process used to designate families of sequences that do not show cross hybridization behavior is generally illustrated in Figure 1). Depending on the application for which these sequence families will be used, various rules are designed. A certain number of rules may specify limitations for sequence composition (such as those described in the previous paragraph). The other rules are used to assess whether two sequences are too similar. Based on these rules, a computer program can derive families of sequences that show minimal cross-hybridization behavior or do not show it. The exact procedure used by the computer program is not crucial since various computer programs can derive similar families based on these rules. For example, such a program is described in International Patent Application No. PCT / CA 01/00141 published as WO 01/59151 on August 16, 2001. Other programs may use different procedures, such as those summarized below.

A first method of generating a maximum number of polynucleotide sequences exhibiting minimal cross hybridization begins with any number of sequences without cross hybridization, for example only one sequence, and increases the family as follows. A certain number of sequences is generated and compared with the sequences already in the family. Generated sequences that show too much similarity to sequences already in the family are omitted. Among the "candidate sequences" that remain, a sequence is selected and added to the family. The other candidate sequences are then compared with the selected sequence, and those that show too much similarity are omitted. A new sequence of the remaining candidate sequences is selected, if any, and added to the family, and so on until there is no candidate sequence. In this phase, the process can be repeated (generating a certain number of sequences and comparing them with the sequences in the family, etc.) as often as desired. The family obtained at the end of this procedure only contains sequences that exhibit minimal cross hybridization.

A second method of generating a maximum number of polynucleotide sequences exhibiting minimal cross hybridization begins with a family of fixed size polynucleotide sequences. Sequences of this family can be randomly generated or designed by some other procedure. Many sequences in this family may not be compatible with each other, because they show too much similarity and do not exhibit minimal cross hybridization. Therefore, it is necessary to replace some sequences with new ones, with less similarity! One way to achieve this is to repeatedly replace a family sequence with the best sequence (that is, the one with the least similarity) between a certain number of sequences (for example, randomly generated) that are not part of the family. This process can be repeated until the sequence family shows minimal similarity, hence minimal cross hybridization, or until an established number of substitutions have occurred. If, at the end of the process, some sequences do not obey the similarity rules that have been established, they can be removed from the family, thus providing a somewhat smaller family that only contains sequences that have minimal cross hybridization. Some additional rules may be added to this procedure in order to make it more effective, such as rules to determine which sequence will be replaced.

Procedures of this type have been used to obtain the 1168 labels that do not exhibit cross hybridization of Table I that are the subject of this patent application.

An embodiment of the invention is a composition comprising molecules for use as labels or tag complements in which each molecule comprises an oligonucleotide selected from a set of oligonucleotides based on the group of sequences set forth in Table IA, in which that each of the numerical identifiers 1 to 3 (see table) is a nucleotide base selected to be different from the others from 1 to 3. According to this embodiment, several different families of specific sets of oligonucleotide sequences are described, depending of the allocation of bases made to numerical identifiers 1 to

3.

The sequences contained in Table I have a mathematical relationship to each other, described as follows.

Suppose that S and T are two DNA sequences of lengths s and t, respectively. Although the term "alignment" of nucleotide sequences is widely used in the field of biotechnology, in the context of this invention the term has a specific meaning illustrated in this case. An alignment of S and T is a 2xp A matrix (being p � syp � t) so that the first (or second) row of A contains the characters of S (or T respectively) in order, interspersed with spaces ps (or pt respectively). It was assumed that no column of the alignment matrix contained two spaces, that is, any alignment in which one column contains two spaces is ignored and is not considered in this case. Columns that contain the same base in both rows are called matings, while columns that contain different bases are called mating mismatches. Each column of an alignment that contains a space in its first row is called an insertion and each column that contains a space in its second row is called a deletion, while an alignment column that contains a space in any row is called a indel. Insertions and deletions within a sequence are presented by the ’-’ character. A hole is a continuous sequence of spaces in one of the rows (which neither immediately precedes nor is immediately followed by another space in the same row) and the length of a hole is the number of spaces in that hole. An internal hole is one in which its first space is preceded by a base and its last space is followed by a base and an internal indel is an indel that belongs to an internal space. Finally, a block is a continuous sequence of pairings (which neither precedes immediately nor is immediately followed by another pair), and the length of a block is the number of pairings in that block. In order to illustrate these definitions, two sequences S = TGATCGTAGCTACGCCGCG (of length s = 19; SEQ ID NO: 1169) and T = CGTACGATTGCAACGT (of length t = 16; SEQ ID NO: 1170) are considered. The exemplary alignment R1 of S and T (where p = 23) is:

R1 alignment:

10 Columns 1 to 4, 9, 10, 12 and 20 to 23 are indels, columns 6, 7, 8, 11, 13, 14, 16, 17 and 18 are matings, and columns 5, 15 and 19 are wrong pairings. Columns 9 and 10 form a gap of length 2, while columns 16 to 18 form a block of length 3. Columns 9, 10 and 12 are internal indels.

A score is assigned to the alignment A of two sequences assigning weights to each of the pairings, 15 mismatches and gaps as follows:

•

the reward for mating m,

•

the penalty for wrong mating mm,

• the penalty for opening a hole og, 20 • the penalty for extending a hole eg.

Once these values are established, a score is assigned to each column of the alignment according to the following rules:

25 1. assign 0 to each column that precedes the first pairing and to each column that follows the last pairing.

2. For each of the remaining columns, assign m if it is a pairing, -mm if it is a wrong pairing, -og-eg if it is the first indel of a hole, -eg if it is an indel but not the first indel of A hole.

30 The alignment score A is the sum of the scores of its columns. An alignment is said to be of maximum score if no other alignment of the two same sequences has a higher score (with the same values of m, mm, og and eg). A person in the field will recognize this procedure of scoring an alignment as the score of a local alignment (as opposed to a global one) with

35 penalties for related holes (ie penalties for holes that can be distinguished between the first indel of a hole and the other indels). It will be appreciated that the total number of indels that open a gap is the same as the total number of gaps and that an internal indel is not one of those assigned a 0 in rule (1) above. It will also be noted that rule (1) above assigns a 0 for non-internal mismatches. An internal mating mismatch is an erroneous mating that is preceded and followed (not necessarily by

40 immediately) by mating.

As an illustration, if the values of m, mm, og and eg are set to 3, 1, 2 and 1 respectively, the alignment R1 has a score of 19, determined as shown below:

45 R1 alignment score

Note that for two given sequences S and T, there are numerous alignments. There are often several high score alignments.

Based on these alignments, five sequence similarity measures are defined as follows. For two sequences S and T, and weights {m, mm, og, eg}:

• M1 is the maximum number of pairings throughout all internal indel-free alignments;

• M2 is the maximum length of a block along all alignments; 5

•

M3 is the maximum number of pairings throughout all high score alignments;

•

M4 is the maximum sum of the lengths of the two longest blocks along all the alignments of

high score; 10

• M5 is the maximum sum of the lengths all the blocks of length at least 3, along all the maximum scoring alignments.

Note that, by definition, the following inequalities are obtained between these similarity measures: M4 M3 and

15 M5 M3. In addition, in order to determine M2 it is sufficient to determine the maximum length of a block along all internal indel-free alignments. For two given sequences, the values of M3 to M5 may vary depending on the values of the weights {m, mm, og, eg}, but not of M1 and M2.

For weights {3, 1, 2, 1}, the alignment illustrated is not a maximum scoring alignment of the two sequences

20 example. But for weights {6, 6, 0, 6} it is; hence, this alignment shows that for these two example sequences, and weights {6, 6, 0, 6}, M2 3, M3 9, M4 6 and M5 6. In order to determine the exact values of M1 a M5, it is necessary to consider all the necessary alignments. M1 and M2 can be found by examining the s + t-1 free alignments of internal indels, in which s and t are the lengths of the two sequences considered. Mathematical tools known as dynamic programming can be implemented on a computer and

25 used to determine M3 to M5 very quickly. Using a computer program to perform these calculations, it was determined that:

•

with weights {6, 6, 0, 6}, M1 = 8, M2 = 4, M3 = 10, M4 = 6 and M5 = 6;

•

with weights {3, 1, 2, 1), M1 = 8, M2 = 4, M3 = 10, M4 = 6 and M5 = 4.

According to the preferred embodiment of this invention, two sequences S and T each of length 24 are too similar if at least one of the following occurs:

• M1> 16 or 35 • M2> 13 or

•

M3> 20 or

•

M4> 16 or

•

M5> 19

40 when any of the weights {6, 6, 0, 6}, or {6, 6, 5, 1}, or {6, 2, 5, 1}, or {6, 6, 6, 0} are used . In other words, the five similarity measures between S and T are determined for each of the four previous sets of weights, and checked against these thresholds (for a total of 20 tests).

The previous thresholds of 16, 13, 20, 16 and 19, and the previous sets of weights were used to obtain the

45 sequences listed in Table I. Therefore, additional sequences may be added to those in Table I provided that the above alignment rules are followed for all sequences.

It is also possible to alter the thresholds M1, M2, etc., while remaining within the scope of this invention. Therefore, it is possible to substitute or add sequences to those in Table I, or more generally to those in Table IA for

50 obtain other sets of sequences that would show a relatively low cross hybridization. More specifically, a set of 24-mere sequences in which there are no two sequences that are too similar, in which too similar is defined as:

• M1> 19 or 55 • M2> 17 or

•

M3> 21 or

•

M4> 18 or

•

M5> 20

60 when any of the weights {6, 6, 0, 6}, or {6, 6, 5, 1), or {6, 2, 5, 1}, or {6, 6, 6, 0} are used , would also show low cross hybridization. Reduction of any of the threshold values provides sets of sequences with even minor cross hybridization. Alternatively, "too similar" can also be defined as:

• M1> 19 or 65 • M2> 17 or

•

M3> 21 or

•

M4> 18 or

•

M5> 20

when any of the weights {3, 1, 2, 1} are used. Alternatively, other combinations of weights will lead to sets of sequences with low cross hybridization.

Note that using weights {6, 6, 0, 6} is equivalent to using weights {1, 1, 0, 1}, or weights {2, 2, 0, 2}, ... (that is, for any two sequences, the values of M1 to M5 are exactly the same whether weights {6, 6, 0, 6} or {1, 1, 0, 1} or {2, 2, 0, 2} or any another multiple of {1, 1, 0, 1}).

When dealing with sequences of length other than 24, or sequences of various lengths, the definition of similarity can be adjusted. Such adjustments are obvious to those skilled in the art. For example, when comparing a sequence of lengths L1 with a sequence of length L2 (being L1 <L2), they can be considered too similar when

M1> 19/24 x L1 M2> 17/24 x L1 M3> 21/24 x L1 M4> 18/24 x L1 M5> 20/24 x L1

When any of the weights {6, 6, 0, 6}, or {6, 6, 5, 1}, or {6, 2, 5, 1} or {6, 6, 6, 0} are used.

The polynucleotide sequences can be composed of a subset of natural bases, most preferably A, T and G. Sequences that are deficient in a base have useful characteristics, for example, in reducing the potential formation of secondary structures or a potential reduced to present cross hybridization with nucleic acids in nature. In addition, it is preferable to present tag sequences that behave isothermally. This can be achieved, for example, by maintaining a constant base composition for all sequences such as six G and eighteen A or T for each sequence. Additional sets of sequences can be designed by extrapolating into the original family of sequences that do not exhibit cross hybridization by simple procedures known to those skilled in the art.

In order to validate the sequence set, a subset of sequences from the family of 1168 sequence tags was selected and characterized, in terms of the ability of these sequences to form specific duplex structures with their complementary sequences, and the potential to cross hybridization within the sequence set. See example 1, below. The subset of 100 sequences was randomly selected, and analyzed using the Luminex100 LabMAP ™ platform. The 100 sequences were chemically immobilized on the set of 100 different Luminex microsphere populations, so that each specific sequence was coupled with a spectrally different population of microspheres. The combination of 100 probes immobilized in microspheres was then hybridized with each of the corresponding 100 complementary sequences. Each sequence was examined individually to determine its specific hybridization with its complementary sequence, as well as to determine its non-specific hybridization with the other 99 sequences present in the reaction. This analysis demonstrated the propensity of each sequence to hybridize only with its complement (perfect pairing), and to not show cross hybridization appreciably with any of the other oligonucleotides present in the hybridization reaction.

It is within the capacity of a person skilled in the art, given the family of sequences in Table I, to modify the sequences, or to add other sequences while largely retaining the property of minimal cross hybridization that the polynucleotides of the table have shown to present. I.

There are 1168 polynucleotide sequences given in Table I. Since 1168 of this family of polynucleotides can act with each other as a set that exhibits minimal cross hybridization, then any plurality of polynucleotides that is a subset of 1168 can also act as a set of polynucleotides that show minimal cross hybridization. An application in which, for example, 30 molecules are to be classified using a family of labels and polynucleotide label complements could therefore use any group of 30 sequences shown in Table I. This does not mean that it can be found in one direction. practical that some subsets are more preferred than others. For example, it can be found that a particular subset is more tolerant of a wider variety of conditions under which hybridization is performed before the degree of cross hybridization becomes unacceptable.

It may be desirable to use polynucleotides that are shorter in length than the 24 bases of those in Table I. A family of sub-sequences (i.e., submarines of the illustrated sequences) could be chosen based on those contained in Table I which have only 10 bases per sequence, provided that the sub-sequences are chosen to preserve homology properties between any two of the family sequences important for their lack of cross hybridization.

Sequence selection using this approach would be suitable for a computerized process. Therefore, for example, a succession of 10 contiguous bases of the first 24-mer molecule could be selected from Table I: AAATTGTGAAAGATTGTTTGTGTA (SEQ ID NO: 1).

Then the same sequence of contiguous bases of the second 24-mer molecule could be selected and compared to determine the similarity against the first sequence chosen: GTTAGAGTTAATTGTATTTGATGA (SEQ ID NO: 2). A systematic pairwise comparison could then be carried out to determine if similarity requirements are violated. If the sequence pair does not violate any established property, a sub-sequence of 10 mer of the third 24-mer sequence of table I can be selected, and compared with each of the first two sequences of 10 groupers (in a pairwise fashion for determine their compatibility with them, etc. In this way, a family of sequences of 10 numbers can be developed.

It is within the scope of this invention, to obtain families of sequences containing sequences of 11 groupers, 12 groupers, 13 groupers, 14 groupers, 15 groupers, 16 groupers, 17 groupers, 18 groupers, 19 groupers, 20 groupers, 21 groupers, 22 mere and 23 mere in analogy to that shown for sequences of 10 groupers.

It may be desirable to present a family of sequences in which there are sequences of greater length than the 24-meter sequences shown in Table I. It is within the capacity of one skilled in the art, given the family of sequences shown in the table. I, get a family of sequences of this type. One possible approach would be to insert in each sequence in one or more locations a nucleotide, unnatural base or analogue so that the longest sequence should not have a similarity greater than any two of the original sequences that do not exhibit cross hybridization of Table I and the addition of additional bases to the tag sequences should not result in a major change in the thermodynamic properties of the tag sequences of that set, for example, the GC content must be maintained between 10% -40% with a variance with respect to the average of 20%. This procedure of insertion of bases could be used to obtain, for example, a family of sequences of up to 40 bases in length.

Given a particular family of sequences that can be used as a family of tags (or tag add-ons), for example, those in Table I, an expert will recognize variant families that work equally well.

Taking again the sequences of table I for example, each T could become an A and vice versa and a significant change in cross-hybridization properties would not be expected. This would also be true if each G became a C.

In addition, all sequences of a family could be taken to be constructed in the 5’-3 ’sense, as is the convention, or all sequence constructions could be in the opposite direction (3’-5’).

There are additional modifications that can be made. For example, C has not been used in the sequence family. The substitution of C instead of one or more G of a particular sequence would produce a sequence that has at least as low a homology with any other family sequence as the one presenting the particular sequence chosen for the modification. Therefore, it is possible to replace C instead of one or more G in any of the sequences shown in Table I. Similarly, it is possible to substitute C instead of one or more A, or it is possible to replace C instead of a or T.

It is preferred that the sequences of a given family be of the same length, or approximately equal. All sequences of a family of sequences of this invention have a length that has a tolerance of five bases of the base length of the family mean. More preferably, all sequences have a tolerance of four bases of the average base length. More preferably, all or almost all sequences have a tolerance of three bases of the average family length of bases. Even better, all or almost all sequences have a length that has a tolerance of two of the base length of the family average, and even better, a tolerance of one of the base length of the family average.

It is also possible for one skilled in the art to derive sets of sequences from the family of sequences described herein and eliminate sequences that would be expected to exhibit undesirable hybridization properties.

Procedures for the synthesis of oligonucleotide families

Preferably, oligonucleotide sequences of the invention are synthesized directly by conventional phosphoramidite synthesis approaches and the like (Caruthers et al, Methods in Enzymology; 154, 287-313: 1987; Lipshutz et al, Nature Genet .; 21, 20-24 : 1999; Fodor et al, Science; 251, 763-773: 1991). Alternative chemicals may also be used, which involve unnatural bases such as peptide nucleic acids or modified nucleosides that offer advantages in duplex stability (Hacia et al; Nucleic Acids Res; 27: 4034-4039, 1999; Nguyen et al, Nucleic Acids Res .; 27, 1492-1498: 1999; Weiler et al, Nucleic Acids Res .; 25, 2792-2799: 1997).

It is also possible to synthesize the oligonucleotide sequences of this invention with main structures of alternate nucleotides such as phosphorothioate or phosphoramidate nucleotides. Methods involving synthesis can also be employed through the addition of sequence blocks gradually (Lyttle et al. Biotechniques, 19: 274-280 (1995). Synthesis can be carried out directly on the substrate to be used as solid phase support for the application or the oligonucleotide can be cleaved from the support for use in solution or coupling to a second support.

Solid phase brackets

There are several different solid phase supports that can be used with the invention. They include but are not limited to slides, plates, chips, membranes, beads, microparticles and the like. Solid phase supports can also vary in the materials they are composed of including plastic, glass, nylon, polystyrene, silica gel, latex and the like. The surface of the support is coated with the complementary tag sequences by any conventional means of attachment.

In preferred embodiments, the family of tag complement sequences is derivatized to allow binding to a solid support. Many methods of derivatizing a nucleic acid for binding to a solid support are known in the art (Hermanson G., Bioconjugate Techniques; Acad. Press: 1996). The sequence tag can be attached to a solid support through covalent or non-covalent bonds (Iannone et al, Cytometry; 39: 131140, 2000; Matson et al, Anal. Biochem .; 224: 110-106, 1995; Proudnikov et al, Anal Biochem; 259: 34-41, 1998; Zammatteo et al, Analytical Biochemistry; 280: 143-150, 2000). The sequence tag can be conveniently derivatized for binding to a solid support by incorporating modified nucleic acids at the 5 'or 3'-terminal locations.

A variety of moieties useful for binding to a solid support (eg, biotin, antibodies, and the like), and methods for binding them to nucleic acids are known in the art. For example, an amine modified nucleic acid base (available from, for example, Glen Research) can be attached to a solid support (e.g., Covalink-NH, a surface of grafted polystyrene with secondary amino groups, available from Nunc) to through a bifunctional crosslinking agent (e.g., bis (sulfosuccinimidyl suberate), available from Pierce). Additional spacer residues may be added to reduce the steric hindrance between the rest of the capture and the surface of the solid support.

Union of labels to analytes for classification

A family of oligonucleotide tag sequences can be conjugated to a population of analytes, most preferably polynucleotide sequences in several different ways including but not limited to direct chemical synthesis, chemical coupling, ligation, amplification, and the like. Sequence tags that have been synthesized with primer sequences can be used for enzymatic extension of the primer on the target, for example in PCR amplification.

Detection of single nucleotide polymorphisms using primer extension

There are several areas of genetic analysis in which families of sequences that do not have cross hybridization can be applied including diagnosis of diseases, analysis of single nucleotide polymorphisms, genotyping, expression analysis and the like. Such an approach to genetic analysis, called the primer extension procedure (also known as genetic bit analysis (Nikiforov et al, Nucleic Acids Res .; 22, 4167-4175: 1994; Head et al Nucleic Acids Res .; 25, 5065-5071: 1997)), is an extremely precise procedure for the identification of the nucleotide located at a specific polymorphic site within the genomic DNA. In conventional primer extension reactions, a portion of genomic DNA containing a defined polymorphic site is amplified by PCR using primers flanking the polymorphic site. In order to identify which nucleotide is present at the polymorphic site, a third primer is synthesized so that the polymorphic position is immediately located at 3 ’with respect to the primer. A primer extension reaction containing the amplified DNA, the primer for the extension, is configured up to 4 dideoxynucleoside triphosphates (each labeled with a different fluorescent dye) and a DNA polymerase such as the Klenow subunit of the DNA polymerase 1. Using dideoxynucleotides ensures that a single base is added to the 3 'end of the primer, a site corresponding to the polymorphic site. In this way, the identity of the nucleotide present at a specific polymorphic site can be determined by the identity of the fluorescent dye-labeled nucleotide that is incorporated into each reaction. A major drawback of this approach is its poor performance. Each primer extension reaction is carried out independently in a separate tube.

Universal sequences can be used to enhance the performance of the primer extension assay as follows. A region of genomic DNA containing multiple polymorphic sites is amplified by PCR. Alternatively, several genomic regions containing one or more polymorphic sites are each amplified together in a multiplexed PCR reaction. The primer extension reaction is carried out as described above except that the primers used are chimeric, each containing a unique universal label at the 5 ′ end and the sequence for extension at the 3 ′ end. In this way, each sequence

gene specific would be associated with a specific universal sequence. The chimeric primers would be hybridized with the amplified DNA and primer extension is carried out as described above. This would result in a mixed combination of extended primers, each with a specific fluorescent dye characteristic of the incorporated nucleotide. After the primer extension reaction, the extension reactions mixed with an alignment containing probes that are inverse complements of the universal sequences in the primers are hybridized. This would segregate the products of various primer extension reactions in differentiated combinations. The fluorescent dye present in each spot would then identify the nucleotide incorporated in each specific location. Several additional procedures can be performed for the detection of single nucleotide polymorphisms, including but not limited to, allele specific polymerase chain reaction (ASPCR), allele specific primer extension (ASPE) and oligonucleotide binding assay ( OLA) by a person skilled in the art in combination with the sequences described herein.

Kits that use tag sequence families

Sequence families that do not exhibit cross hybridization can be provided in kits for use in, for example, genetic analysis. Such kits include at least one set of sequences that do not exhibit cross hybridization in solution or on a solid support. Preferably, the sequences bind to microparticles and are provided with buffers and reagents that are appropriate for the application. Reagents may include enzymes, nucleotides, fluorescent markers and the like that would be required for specific applications. Instructions for the correct use of the kit for a given application will be provided.

Examples

EXAMPLE 1 - Behavior sequence interference in beads

A group of 100 sequences, randomly selected from Table I, was tested to determine the feasibility for use as a family of oligonucleotides that exhibit minimal cross hybridization. The 100 selected sequences are indicated separately in Table I along with the numbers assigned to the sequences in the tests.

The tests were performed using the Luminex LabMAP ™ platform available from Luminex Corporation, Austin, Texas, USA. The hundred sequences, used as probes, were synthesized as oligonucleotides by Integrated DNA Technologies (IDT, Coralville, Iowa, USA). Each probe included a C6 amino linking group coupled to the 5 ’end of the oligonucleotide through a C12 ethylene glycol spacer. The C6 amino-binding molecule is a six-carbon spacer that contains an amine group that can be used to bind the oligonucleotide to a solid support. One hundred oligonucleotide targets (probe complements) were also synthesized, the sequence of each being the inverse complement of the 100 probe sequences, by IDT. Each target was marked at its 5 ’end with biotin. All oligonucleotides were purified using conventional desalination procedures, and reconstituted to a concentration of approximately 200 µM in distilled, sterile water for use. Oligonucleotide concentrations were determined spectrophotometrically using the extinction coefficients provided by the supplier.

Each probe was coupled by its amino binding group to a carboxylated fluorescent microsphere of the LapMAP system according to the Luminex100 protocol. The microsphere, or pearl, for each probe sequence has unique or spectrally different light absorption characteristics, which allows each probe to be distinguished from the other probes. Sediments of mother solution beads were dispersed by sonication and then vortexing. For each pearl population, five million microspheres (400 μl) were removed from the mother liquor tube using filter tips and added to a 1.5 ml Eppendorf tube (USA Scientific). The microspheres were then centrifuged, the supernatant was removed, and the beads were resuspended in 25 μl of MES (2 (N-morpholino) ethanesulfonic acid) (Sigma) 0.2 M, pH 4.5, followed by vortexing and sonication One nmol of each probe (in a volume of 25 μl) was added to its corresponding pearl population. A volume of 2.5 μl of EDC crosslinking agent (1-ethyl-3- (3-dimethylaminopropyl) carbodiimide hydrochloride (Pierce), prepared immediately prior to use, was added by adding 1.0 ml of sterile ddH2O to 10 mg of EDC powder, to each population of microspheres, then the pearl mixtures were incubated for 30 minutes at room temperature in the dark with periodic vortex agitation, then a second 2.5 μl aliquot of freshly prepared EDC solution was added followed by an additional incubation for 30 minutes in the dark After the second incubation with EDC, 1.0 ml of 0.02% Tween-20 (BioShop) was added to each pearl mixture and vortexed. the microspheres, the supernatant was removed, and the beads were resuspended in 1.0 ml of 0.1% sodium dodecyl sulfate (Sigma), the beads were centrifuged again and the supernatant was removed, the coupled beads were resuspended in 100 μl of MONTH 0.1 M pH 4.5 Pearl concentrations were then determined by diluting each preparation 100 times in ddH2O and enumerating it using a Neubauer BrightLine hemocytometer. The coupled beads were stored as individual populations at 8 ° C protected from light.

The relative density of oligonucleotide probes in each pearl population was assessed by labeling

ends by terminal deoxynucleotidyl transferase (TdT) with biotin-ddUTP. TdT was used to label the 3 'ends of "single stranded" DNA with a labeled ddNTP. Briefly, 180 μl of the combination of 100 pearl populations (equivalent to approximately 4000 of each type of pearl) that were to be used for hybridization in an Eppendorf tube were pipetted and centrifuged. The supernatant was removed, and the beads were washed in 1x TdT buffer. The beads were then incubated with a labeling reaction mixture, which consisted of 5x TdT buffer, 25 mM CoCl2, and 1000 pmol of biotin-16-ddUTP (all Roche reagents were purchased). The total reaction volume was made up to 85.5 μl with sterile distilled H2O and the samples were incubated in the dark for 1 hour at 37 ° C. A second enzyme aliquot was added, followed by a second incubation for 1 hour. Samples were run in duplicate, as was done with the negative control, which contained all components except TdT. In order to remove the unincorporated biotin-ddUTP, the beads were washed 3 times with 200 µl of hybridization buffer, and the beads were resuspended in 50 µl of hybridization buffer after the final wash. The biotin marker was detected spectrophotometrically using SA-PE (streptavidinophoreitrin conjugate). Streptavidin binds to biotin and phycoerythrin is spectrally different from probe beads. The stock solution was diluted 10 mg / ml SA-PE 100 times in hybridization buffer, and 15 µl of the diluted SA-PE was added directly to each reaction and incubated for 15 minutes at 37 ° C. The reactions in the Luminex100 LabMAP apparatus were analyzed. Acquisition parameters were set to measure 100 events per bead using a sample volume of 50 μl.

The results obtained in Figure 2 are shown. As can be seen, the average fluorescence intensity (MFI) of the beads varies from 840.3 to 3834.9, a range of 4.56 times. Assuming that the labeling reactions are complete for all oligonucleotides, this illustrates the signal strength that would be obtained for each type of bead at this concentration if the target (i.e., the labeled complement) bound to the entire probe sequence. The possible extension.

Cross hybridization of the targets to the probes was evaluated as follows. 100 oligonucleotide probes bound to 100 different pearl populations were combined, as described above, to generate a masterbatch of master beads, allowing multiplexed reactions to be carried out. The combination of immobilized microspheres-probes with each biotinylated target was then individually hybridized. Therefore, each target was examined individually to determine its specific hybridization with its complementary sequence immobilized in pearl, as well as to determine its non-specific hybridization with the other 99 universal sequences immobilized in pearl present in the reaction. For each hybridization reaction, 25 µl of pearl mixture (containing approximately 2500 of each population of beads in hybridization buffer) was added to each well of a 96-well Thermowell PCR plate and equilibrated at 37 ° C. Each target was diluted to a final concentration of 0.002 fmol / µl in hybridization buffer, and 25 µl (50 fmol) was added to each well, providing a final reaction volume of 50 µl. The hybridization buffer consisted of 0.2 M NaCl, 0.1 M Tris, 0.08% Triton X-100, pH 8.0 and hybridizations were performed at 37 ° C for 30 minutes. Each target was analyzed in triplicate and six background samples (i.e. no target) were included in each plate. An SA-PE conjugate was used as an indicator, as described above. The stock solution was diluted 10 mg / ml SA-PE 100 times in hybridization buffer, and 15 µl of the diluted SA-PE was added directly to each reaction, without removal of the unbound target, and incubated for 15 minutes at 37 ° C Finally, an additional 35 µl of hybridization buffer was added to each well, resulting in a final volume of 100 µl per well before analysis in the Luminex100 LabMAP. Acquisition parameters were set to measure 100 events per bead using a sample volume of 80 μl.

Percent hybridization was calculated for any event in which the net MFI was at least 3 times the zero bottom of the target. In other words, a calculation was made for any sample in which (MFIsample-MFI zero target fund) / MFI zero fund target 3.

The median of the net fluorescence intensity (MFI sample-MFI zero target fund) generated for the 10,000 possible target / probe combinations was calculated. As there are 100 probes and 100 targets, there are 100 x 100 = 10,000 possible different possible interactions of which 100 are the result of perfect hybridizations. The remaining 9900 results from the hybridization of a target with an erroneous pairing probe. A cross hybridization event is then defined as a non-specific event whose median net fluorescence intensity exceeds 3 times the zero background of the target. In other words, only one interference calculation will be performed for any sample in which (MFIsample-MFI zero target fund) / MFI zero target fund 3. Cross hybridization events were quantified by expressing the value of the cross hybridization signal as a percentage of the perfect pairing hybridization signal with the same probe.

The results obtained in Figure 3 are illustrated. The ability of each target to be specifically recognized by its pairing probe is shown. Of the possible 9900 non-specific hybridization events that could have occurred when each of the 100 targets were exposed to the combination of 100 probes, 6 events were observed. Of these 6 events, the largest non-specific event generated a signal equivalent to 5.3% of the observed signal for the perfect pairing pair (ie, specific hybridization event).

Therefore, each of the 100 targets was examined individually to determine specific hybridization with its complementary sequence incorporated on a microsphere, as well as to determine non-specific hybridization with the complements of the other 99 target sequences. Representative hybridization results for the target (complement of probe 90, table I) are shown in Figure 4. It was found that probe 90 is

5 hybridized only with its perfect mating target. No cross hybridization was observed with any of the other 99 targets.

The previous results demonstrate the possibility of incorporating the 1168 sequences of table I, or any subset of them, in a multiplexed system with the expectations that most if not all

10 sequences can be distinguished from the others by hybridization. That is, it is possible to distinguish each target from the other targets by hybridization of the target with its precise complement and minimal hybridization with supplements of the other targets.

EXAMPLE 2 - Label sequences used in the polynucleotide classification

The family of sequence tags without cross-hybridization or a subset thereof can be linked to oligonucleotide probe sequences during synthesis and used to generate amplified probe sequences. In order to test the viability of PCR amplification with sequence tags without cross hybridization and subsequently direct each respective sequence to its appropriate location in

20 two-dimensional or pearl alignments, the following experiment was conceived. A 24-mer tag sequence specifically 5’-3 ’can be connected to a specific p53 exon sequence (20-mer reverse primer). The connection p53 sequence represents the inverse complement of the nucleotide gene sequence. To facilitate the subsequent generation of single stranded DNA after amplification, the reverse tagger can be synthesized with a phosphate modification (PO4) at the 5 ’end. A second can also be generated.

25 PCR primer for each desired exon, represented by the direct amplification primer (5’-3 ’). In this case, the direct primer can be labeled with a 5′-biotin modification to allow detection with Cy3avidin or equivalent.

A practical example of the description mentioned above is as follows: for exon 1 of sequence 30 of the p53 tumor suppressor gene, the following inverse primer-tag can be generated (SEQ ID NO: 1171):

Tag sequence # 3 Inverse of exon 1

The above numbering, the exon 1 reverse primer represents the genomic nucleotide positions in the indicated bases. The corresponding direct primer sequence of exon 1 (SEQ ID NO: 1172) is as follows:

In combination, these primers will amplify a 214 bp product plus a 24 bp label extension producing a total size of 238 bp.

Once amplified, the PCR product can be purified using a QIAquick PCR purification kit and the resulting DNA can be quantified. To generate single stranded DNA, the DNA is digested with λexonuclease resulting in the exposure of a single stranded (anti-tag) sequence complementary to the tag sequence covalently linked to solid phase alignment. The resulting product is heated to 95 ° C for 5 minutes and then applied directly to the alignment at a

50 concentration of 10-50 nM. After hybridization and concurrent classification, exon 1 tag sequences are visualized using Cy3-streptavidin. In addition to direct visualization of the biotinylated product, the product itself can now act as a substrate for further analysis of the amplified region, such as SNP detection and haplotype determination.

55 Definitions

No cross hybridization: describes the absence of hybridization between two sequences that are not perfect complements of each other.

Cross hybridization: the hydrogen bonds of a single stranded DNA sequence that is partially complementary, but not totally, to a single stranded substrate.

5 Homology or similarity: how closely two or more separate strands of DNA are related to each other, based on their base sequences.

Analogous: the symbols A, G, T / U, C take their usual meaning in the art herein. In the case of T and U, one skilled in the art would understand that these are equivalent to each other with respect to the bonding properties of the intercatenary hydrogen bond (Watson-Crick) at play in the context of this invention. The two bases are therefore interchangeable and hence the designation of T / U. A chemical compound, which resembles a nucleotide base is an analogue thereof. A base that does not normally appear in the DNA but can replace those that do, despite minor differences in structure. Particularly useful analogs in this invention are those of naturally occurring bases that can be inserted in their respective places

15 when desired. Such an analog is any unnatural base, such as peptide nucleic acids and the like that undergo normal Watson-Crick mating in the same manner as the naturally occurring nucleotide base to which it corresponds.

Complement: the opposite or "specular" image of a DNA sequence. A complementary DNA sequence 20 has an "A" for each "T" and a "C" for each "G". Two complementary strands of single stranded DNA, for example a tag sequence and its complement, will join to form a double stranded molecule.

Complementary DNA (cDNA): DNA that is synthesized from a messenger RNA template; The single-stranded form is often used as a probe in physical mapping.

Oligonucleotide: refers to a short nucleotide polymer by which the nucleotides can be natural nucleotide bases or analogs thereof.

Label: refers to an oligonucleotide that can be used to specifically classify analytes with at least 30 other oligonucleotides that when used together do not exhibit cross hybridization.

Table I

Sequence SEQ ID NO: No. in ex. 1 Sequence SEQ ID NO: No. in ex. 1 Sequence SEQ ID NO: No. in ex. 1 Sequence SEQ ID NO: No. in ex. 1 Sequence SEQ ID NO: No. in ex. 1 Sequence SEQ ID NO: No. in ex. 1 Sequence SEQ ID NO: No. in ex. 1 Sequence SEQ ID NO: No. in ex. 1 Sequence SEQ ID NO: No. in ex. 1 Sequence SEQ ID NO: No. in ex. 1 Sequence SEQ ID NO: No. in ex. 1 Sequence SEQ ID NO: No. in ex. 1 Sequence SEQ ID NO: No. in ex. 1 Sequence SEQ ID NO: No. in ex. 1 Sequence SEQ ID NO: No. in ex. 1 Sequence SEQ ID NO: No. in ex. 1 Sequence SEQ ID NO: No. in ex. 1 Sequence SEQ ID NO: No. in ex. 1 Sequence SEQ ID NO: No. in ex. one

Sequence SEQ ID NO: No. in ex. 1 Sequence SEQ ID NO: No. in ex. one

Sequence SEQ ID NO: No. in ex. one

All the bibliography referred to in this specification is incorporated as a reference to this report.

The scope of protection sought for the invention described herein is defined by the appended claims. It will also be understood that any element mentioned above or in the claims may be combined with the elements of any claim. In particular, elements of a dependent claim can be combined with any element of a claim on which it depends, or with any other compatible element of the invention.

10 This application claims the priority of provisional US patent applications No. 60 / 263,710 and No. 60 / 303,799, filed on January 25, 2001 and July 10, 2001. These two documents are incorporated by reference herein.

Claims (30)

1. Composition comprising a plurality of oligonucleotide tag complements that exhibit minimal cross hybridization, in which:

(to)

each oligonucleotide is free of residues either of cytosine or guanine,

(b)

no two cytosine or guanine residues located adjacent to each other in an oligonucleotide and any two cytosine or guanine residues are separated by a maximum of 6 different cytosine or non-guanine residues, respectively,

(C)

the number of cytosine or guanine residues in each oligonucleotide does not exceed L / 4 in which L is the number of bases in the oligonucleotide,

(d)

the length of each oligonucleotide differs by no more than five bases from the average length of all oligonucleotides in the composition,

(and)

each oligonucleotide does not contain 4 or more contiguous identical nucleotides,

(F)

the number of guanine or cytosine residues in each oligonucleotide does not vary from the average number of guanine or cytosine residues in all other oligonucleotides of the composition in more than one,

(g)

each tag complement contains a guanine residue or a cytosine residue respectively, within seven residues of one end of the oligonucleotide,

(h)

when each oligonucleotide tag complement is exposed to hybridization conditions comprising 0.2 M NaCl, 0.1 M Tris, 0.08% Triton X-100, pH 8.0 at 37 ° C, the maximum degree of hybridization between the label complement and a label that is not completely complementary to the label complement does not exceed 30% of the degree of hybridization between the label complement and its completely complementary label; Y

(i)

in which each oligonucleotide is between 18 and 30 nucleotides in length.

2.

Composition according to claim 1, wherein each oligonucleotide is free of cytosine residues.

3.

Composition according to any of the preceding claims, wherein when each oligonucleotide tag complement is exposed to hybridization conditions comprising 0.2 M NaCl, 0.1 M Tris, 0.08% Triton X-100, pH 8 , 0 to 37 ° C, the maximum degree of hybridization between the label complement and a label that is not completely complementary to the label complement does not exceed 25% of the degree of hybridization between the label complement and its completely complementary label.

Four.

Composition according to any of the preceding claims, wherein when each oligonucleotide tag complement is exposed to hybridization conditions comprising 0.2 M NaCl, 0.1 M Tris, 0.08% Triton X-100, pH 8 , 0 to 37 ° C, the maximum degree of hybridization between the label complement and a label that is not completely complementary to the label complement does not exceed 20% of the degree of hybridization between the label complement and its completely complementary label.

5.

Composition according to any of the preceding claims, wherein when each oligonucleotide tag complement is exposed to hybridization conditions comprising 0.2 M NaCl, 0.1 M Tris, 0.08% Triton X-100, pH 8 , 0 to 37 ° C, the maximum degree of hybridization between the label complement and a label that is not completely complementary to the label complement does not exceed 15% of the degree of hybridization between the label complement and its completely complementary label.

6.

Composition according to any of the preceding claims, wherein the length of each oligonucleotide in the composition is identical.

7.

Composition according to any of the preceding claims, wherein the number of guanine or cytosine residues in each oligonucleotide is the same.

8.

Composition according to any of the preceding claims, wherein each oligonucleotide is between 22 and 26 nucleotides in length.

9.

Composition according to any of the preceding claims, wherein each oligonucleotide comprises 24 residues.

10.

Composition according to claim 9, wherein each oligonucleotide contains 6 guanine residues or

cytosine

eleven.

Composition according to any of the preceding claims, wherein the label complements are fixed to a solid phase support.

12.

Composition according to claim 11, wherein the support is a flat substrate comprising a plurality of spatially addressable regions.

13.

Composition according to claim 11, wherein the label complements are covalently bound to microparticles.

14.

Composition according to any of the preceding claims, wherein the composition comprises 150 label complements.

fifteen.

Composition according to any one of the preceding claims, comprising one hundred and sixty label complements, or comprising one hundred and seventy label complements, or comprising one hundred and eighty label complements, or comprising one hundred and ninety label complements, or comprising two hundred label complements. , or comprising two hundred and twenty label complements, or comprising two hundred and forty label complements, or comprising two hundred and sixty label complements, or comprising two hundred and eighty label complements, or comprising three hundred label complements, or comprising four hundred complements of label, or comprising five hundred label complements, or comprising six hundred label complements, or comprising seven hundred label complements, or comprising eight hundred label complements, or comprising nine hundred label complements, or comprising one thousand complement s tag.

16.

Kit for classifying and identifying polynucleotides comprising one or more solid phase supports comprising a plurality of spatially differentiated regions, each region presenting a uniform population of substantially identical label complements covalently attached thereto and each label complement being selected from an oligonucleotide composition exhibiting minimal cross hybridization according to any one of claims 1 to 15.

17.

Kit according to claim 16, wherein one or more solid phase supports are a flat substrate and wherein a

or more spatially differentiated regions are a plurality of spatially addressable regions.

18.

Kit according to claim 16, wherein one or more solid phase supports are a plurality of microparticles.

19.

Kit according to claim 18, wherein said microparticles each have a diameter in the range between 5 and 40 µm.

twenty.

Kit according to claim 18 or 19, wherein each microparticle is spectrophotometrically unique with respect to each other microparticle having a different oligonucleotide attached thereto.

twenty-one.

Method of analysis of a biological sample comprising a plurality of nucleic acid molecules to determine the presence of a mutation or polymorphism in a locus of each nucleic acid molecule, for each nucleic acid molecule, the method comprising: (a) hybridizing the molecule and a primer, the primer presenting a 5 'sequence presenting the sequence of a tag complementary to the sequence of a tag complement belonging to a family of tag complements according to any one of claims 1 to 15 and one end 3 'extending immediately adjacent to the locus; (b) enzymatically extending the 3 ′ end of the primer in the presence of a plurality of nucleoside triphosphate derivatives each of which: (i) can be enzymatically incorporated into the 3 ′ end of a growing nucleotide chain; (ii) causes the termination of said extension; and (iii) it can be detected in a differential manner, with one another, in which one of said derivatives is complementary to each possible nucleotide present in said locus; (c) specifically hybridize the extended primer formed in step (b) with a tag complement that has the tag complement sequence of (a); and (d) detecting the nucleotide derivative incorporated in the primer in step (b) to identify the base located at the locus of the nucleic acid molecule; wherein each label of (a) is unique to each nucleic acid molecule and steps (a) and (b) are carried out with said nucleic molecules in the presence of another.

22

Method according to claim 21, wherein each respective complement is linked as a uniform population of substantially identical complements in a spatially differentiated region on one or more of said solid phase supports.

2. 3.

Method according to claim 21, wherein each of said label complements comprises a marker, each of said markers being different for the respective complements, and step (d) includes detecting the presence of the different markers for hybridization complexes. respective labels and tag add-ons attached.

24.

Procedure for determining the presence of a target that is suspected of being contained in a mixture, the procedure comprising the following steps: (i) marking the target with a first marker; (ii) provide a first detection moiety that can specifically bind to the target and that includes a first tag; (iii) exposing a sample of the mixture to the detection residue under conditions suitable to allow said specific binding of the residue and the target; (iv) providing a family of tag complements according to any one of claims 1 to 15, the family containing a first tag compliment having a sequence complementary to that of the first tag; (v) expose the sample to the family of label complements under conditions suitable to allow specific hybridization of the first label and its label complement; (vi) determining whether said first detection residue hybridized to a first said label complement is attached to said labeled target to determine the presence or absence of said target in the mixture.

25.

Method according to claim 24, wherein said first label complement is attached to a solid support at a specific location of the support and step (vi) includes detecting the presence of the first marker at said specific location.

26.

Method according to claim 24 or 25, wherein said first label complement comprises a second label and step (vi) includes detecting the presence of the first and second markers in a hybridized complex of the rest and the first label complement.

27.

Method according to any of claims 24 to 26, wherein said target is selected from the group consisting of organic molecules, antigens, proteins, polypeptides, antibodies and nucleic acids.

28.

Method according to any of claims 24 to 27, wherein said target is an antigen and said first molecule is an antibody specific for said antigen.

29.

Method according to any of claims 24 to 28, wherein the antigen is a polypeptide or a protein and the labeling step includes the conjugation of fluorescent molecules, digoxigenin, biotinylation and the like.

30

Method according to any of claims 24 to 27, wherein said target is a nucleic acid and the labeling step includes the incorporation of fluorescent molecules, radiolabeled nucleotide, digoxigenin, biotinylation and the like.