ES2975748T3 - Presentation of bonding agents - Google Patents

Abstract

The present invention relates to a method for preparing a genetic package displaying oligomers of modular antibody domains that bind to a target and a scaffold ligand, as well as to vectors and libraries of genetic packages produced thereby. The invention further relates to methods for selecting suitable linker sequences for use in such oligomer display. (Automatic translation with Google Translate, no legal value)

Description

DESCRIPTION

Presentation of bonding agents

The invention relates to libraries of functional dimers of modular antibody domains comprising a CH2 domain and a CH3 domain, capable of binding to a target and a scaffold ligand.

Monoclonal antibodies have been widely used as scaffolds for binding agents. The basic antibody structure will be explained here using an intact IgG1 immunoglobulin as an example.

Two identical heavy (H) chains and two identical light (L) chains combine to form the Y-shaped antibody molecule. The heavy chains each have four domains. The amino-terminal variable (VH) domains are at the tips of the Y. These are followed by three constant domains: CH1, CH2, and CH3 at the carboxy terminus, at the base of the Y stem. A short stretch, the cam, connects the variable and constant regions of the heavy chains. The hinge connects CH2 and CH3 (the Fc fragment) to the rest of the antibody (the Fab fragments). One Fc and two identical Fab fragments can be produced by proteolytic cleavage of the hinge in an intact antibody molecule. Light chains are built up of two domains, variable (VL) and constant (CL), separated by a cam.

Disulfide bonds in the hinge region connect the two heavy chains. The light chains are coupled to the heavy chains by additional disulfide bonds. Carbohydrate moieties attached at Asn are linked at different positions in constant domains depending on the immunoglobulin class. For IgG1, two disulfide bonds in the hinge region, between the pairs Cys235 and Cys238, link the two heavy chains. The light chains are coupled to the heavy chains by two additional disulfide bonds, between Cys229s in the CH1 domains and Cys214s in the CL domains. Carbohydrate moieties are linked to Asn306 of each CH2, generating a pronounced bulge in the stem of the Y.

These features have profound functional consequences. The variable regions of both the heavy and light chains (VH) and (VL) are located at the "tips" of the Y, where they are positioned to react with antigen. This tip of the molecule is the side on which the N-terminus of the amino acid sequence is located. The stem of the Y protrudes in a way to efficiently mediate effector functions such as complement activation and interaction with Fc receptors, or ADCC and ADCP. Its CH2 and CH3 domains protrude to facilitate interaction with effector proteins. The C-terminus of the amino acid sequence is located on the opposite side of the tip, which can be called the "bottom" of the Y.

Two types of light chains, called lambda (A) and kappa (<k>), are found in antibodies. A given immunoglobulin has either <k> or A chains, never both. No functional difference has been found between antibodies that have either A or k light chains.

Each domain in an antibody molecule has a similar structure of two beta sheets stacked closely against each other in a compressed antiparallel beta barrel. This conserved structure is called the immunoglobulin fold. The immunoglobulin fold of the constant domains contains a 3-stranded sheet stacked against a 4-stranded sheet. The fold is stabilized by hydrogen bonding between the beta strands of each sheet, by hydrophobic bonding between residues of opposite sheets on the interior, and by a disulfide bond between the sheets. The 3-stranded sheet comprises strands C, F, and G, and the 4-stranded sheet has strands A, B, E, and D. The letters A through G indicate the sequential positions of the beta strands along the amino acid sequence of the immunoglobulin fold.

The variable domain fold has 9 beta strands arranged in two sheets of 4 and 5 strands. The 5-stranded sheet is structurally homologous to the 3-stranded sheet of constant domains, but contains the additional strands C' and C''. The rest of the strands (A, B, C, D, E, F, G) have the same topology and similar structure as their homologs in the constant domain immunoglobulin folds. A disulfide bond connects the B and F strands into opposite sheets, as in constant domains.

The variable domains of both heavy and light immunoglobulin chains contain three hypervariable loops, or complementarity determining regions (CDRs). The three CDRs of a V domain (CDR1, CDR2, CDR3) are clustered at one end of the beta barrel. The CDRs are loops that connect beta strands B-C, C'-C", and F-G of the immunoglobulin fold. The residues in the CDRs vary from one immunoglobulin molecule to the next, conferring antigen specificity to each antibody.

The VL and VH domains at the tips of antibody molecules are tightly stacked so that the 6 CDRs (3 in each domain) cooperate in constructing a surface (or pocket) for specific antigen binding. Thus, the natural antigen-binding site of an antibody is composed of the loops connecting the B-C, C'-C'', and F-G strands of the light chain variable domain and the B-C, C'-C" and F-G strands of the heavy chain variable domain.

Loops that are not CDR loops in a native immunoglobulin, or are not part of the antigen binding pocket as determined by the CDR loops and optionally adjacent loops within the CDR loop region, do not have antigen binding or epitope binding specificity, but contribute to the correct folding of the entire immunoglobulin molecule and/or its effector or other functions and are therefore called structural loops for the purpose of the present invention.

The prior art documents show that the immunoglobulin-like scaffold has been employed to date in order to manipulate the existing antigen binding site, thus introducing novel binding properties. In most cases, the CDR regions have been manipulated for antigen binding, in other words, in the case of the immunoglobulin fold, only the natural antigen binding site has been modified in order to change its binding affinity or specificity. There is a large body of literature describing different formats of such engineered immunoglobulins, frequently expressed as single-chain Fv fragments (scFv) or Fab fragments, either displayed on the surface of phage particles or solublely expressed in various prokaryotic or eukaryotic expression systems.

WO06072620A1 describes a method of manipulating an immunoglobulin comprising a modification in a structural loop region to obtain new antigen binding sites. This method is broadly applicable to immunoglobulins and can be used to produce a series of immunoglobulins targeting various antigens. A CH3 library has been shown to be useful for selecting antigen-specific binders.

Although multivalent display of proteins in genetic packages has been described (such as direct phage cloning and display, bacterial display, yeast display), the state of the art relates to monomeric, monovalent display of binding domains, in general. WO9209690 describes phagemid particles displaying a single copy of a fusion protein on the surface of the particle. Thus, it was described to obtain high affinity binders from a library of phagemid particles, also called bacteriophages. Replicable expression vectors are provided comprising genes encoding a binding polypeptide and a phage coat protein to form a gene fusion encoding a fusion protein, which is a chimeric protein of a phagemid particle, the phage coat protein and the binding polypeptide.

US5223409 generally describes the method of fusing a gene encoding a protein of interest to the N-terminal domain of the gene III coat protein of filamentous phage M13. The gene fusion is mutated to form a library of structurally related fusion proteins that are expressed at low levels on the surface of a phagemid particle. Biological selection and screening are employed to identify novel ligands useful as drug candidates.

However, there are some limitations in using such "fusion phage" or monovalent phage display and respective individual fusion proteins. Many biologics occur naturally in oligomeric form. For the purpose of the present invention, oligomeric means dimeric, trimeric or even higher polymeric forms, up to 24 monomers.

Fusion phages according to the state of the art are described as displaying monomeric fusion proteins, mainly because it was thought that higher affinity binders could only be selected from a library if individual fusion proteins were displayed by the phagemid particles. Native proteins are, however, frequently assembled as a dimer or even at a higher degree of oligomerization. In order to obtain dimeric display with a single fusion protein, some techniques have been developed involving conditional stop codons located between the coat protein and the binding polypeptide (Dall'Acqua et al., The Journal of Immunology, 2002, 169: 5171-5180). Thus, soluble monomers of the polypeptides are displayed in addition to those fused to the phage, thus allowing the formation of a dimer. However, such stop codons require propagation in specific suppressor host cells that can translate a stop codon into an amino acid, to provide an appropriate amount of fusion proteins in addition to the soluble binding polypeptides. WO 03/029456 describes the use of multi-chain eukaryotic display vectors for the targeting of immunoglobulin Fab fragments on the surface of yeast cells.

Prior art fusion proteins sometimes involve linker sequences to display larger binding polypeptides. Linker sequences of up to 24 amino acids are typically employed for standard purposes of displaying variable domains of an antibody. See, for example, the pCOMB3x display vector (Hybrid. Hybridomics. 2003 Apr;22(2):97-108. Development of functional human monoclonal single-chain variable fragment antibody against HIV-1 from human cervical B cells. Berry JD, Rutherford J, Silverman GJ, Kaul R, Elia M, Gobuty S, Fuller R, Plummer FA, Barbas CF.)

Brief description of the invention

The invention is the one set forth in the claims.

The invention provides a library containing at least 102 independent clones of functional dimers of modular antibody domains comprising a CH2 domain and a CH3 domain, said dimers being capable of binding a target and a scaffold ligand selected from the group consisting of CD64, CD16, CD32, Fc receptors, FcRn, serum albumin, Protein A, Protein G and Protein L, wherein the scaffold ligand binds to the backbone of each dimer independently of the target specificity of the dimer, and wherein binding of the scaffold ligand to the backbone of the dimer indicates that the dimer is correctly expressed and folded, and wherein each dimer comprises an antigen binding site for said target in a structural loop region of either the CH2 domain or the CH3 domain.

A genetic package may be presented in a cellular or mobilized system, where the mobilized system may be selected from viruses, phages, phagemids, in vitro display systems, mRNA systems, and ribosomal display systems. Alternatively, a cellular system may be selected using yeast, mammalian cells, bacterial cells, bacterial spores, or insect cells.

Oligomers can be formed by oligomerization motifs associated with the structure of said agents, such as leucine zippers, disulfide bonds, electrostatic or hydrophobic motifs.

According to the invention, the oligomers are dimers comprising a CH2 domain and a CH3 domain.

The method described herein may be applied to oligomers that are polypeptides with a target binding site that is directed toward the surface of the genetic package and is proximal to said surface that are biological, such as polypeptides.

Alternatively, appropriate design of a polypeptide with a binding site that is closer to the surface of the gene package than to the environment around the gene package is employed. This may be advantageous for a binding polypeptide with a potential binding site that is closer to the C-terminus than to the N-terminus of the polypeptide, particularly when the binding site is engineered into a C-terminal loop position. When the potential binding site is engineered into a position that is adjacent to the site where the gene package particle is bound, for example to a surface structure of a cell or a virus, it is advantageous to choose a stable construct with defined accessibility of the binding component of said binding agent. C-terminal loop positions are, for example, less accessible than N-terminal loop positions, when fused to the N-terminus of filamentous phage protein 3 because they are exposed and in steric proximity to the gene package.

According to the description, however, a defined structure is provided, such as a true oligomeric or dimeric fusion protein, to allow efficient manipulation of the potential binding site at an N-terminal loop position. One example relates to polypeptides with at least two target binding sites, possibly engineered into the monomeric or oligomeric target binding agent. In some examples, the interaction between the monomeric structures allows for additional structural variations and, therefore, additional potential binding sites.

The modular antibody may be an Fc fragment comprising a binding site at a structural loop position.

In case the genetic package is a filamentous bacteriophage, the preferred fusion structure employed with a bacteriophage involves at least part of an outer surface protein, such as p3, p6 or p8; however, p9 or p10 may also be used.

In case the genetic package is yeast, it is preferred that the oligomer is a fusion protein comprising one of the yeast cell surface receptor proteins selected from the group consisting of alpha-agglutinin, a-agglutinin, Aga1 p, Aga2p or FLO1.

The appropriate genetic package is preferably provided in a particular form and containing a vector encoding at least one of said fusion proteins. An example is a cassette vector, which contains sequences encoding one or more of a fusion protein operably linked to the genetic package. Thus, at least two of the chimeric fusion proteins are linked on the surface of the vector particle. The vector may be, for example, a phagemid.

Also described is an expression system for expressing oligomers of linked modular antibody domains on the surface of a gene package wherein the oligomers are encoded by a single gene and the fusion protein is displayed in at least two copies on the surface of the gene package.

Using the method and means described herein it is possible to display modular antibody oligomers without the need for controlled expression of a soluble form of one of the oligomerizing partners. The technique can be used for molecules such as antibody fragments, even those containing more than two immunoglobulin domains, for example at least four immunoglobulin domains. Thus, difficult constructions involving stop codons, such as amber stop codons, can be avoided. There will be no need to obtain a mixture of fusion proteins and soluble monomers for dimer display. Thus, a preferred technique of managing mixtures of various binding agents can be readily employed, while reducing the risk of insufficient monomer matching. It is also possible to avoid suppressor strains as a host cell. Conventional host cells, with non-suppressor function, can serve as standard for propagating oligomeric fusion proteins.

The fusion between the binding partner and the surface protein of the gene package may be such that no conditional stop codon is present (i.e. no amber, ochre, opal or other similar conditional stop codon) in between. In such a situation, upon infection with a helper phage, the binding partner is present only as a fusion protein and not in soluble form. In order for the dimer (trimer or higher) to form on the surface of the gene package, the linker connecting the binding partner to the gene package needs to be of sufficient length and sufficient flexibility. Linkers that meet this requirement can be selected using the method described above.

Helper phage may be used that have specific properties that favor the display of more than one copy of the fusion protein on the surface of the gene package. An example of such a helper phage is the so-called hyperphage (Rondot S, Koch J, Breitling F, Dubel S. A helper phage to improve single-chain antibody presentation in phage display. Nat Biotechnol. 2001 Jan;19(1) :75-78), which in turn lacks p3 and is therefore entirely dependent on the p3 fusion protein provided by the phagemid to be infectious. The use of such helper phages preferably leads to phage particles carrying more than one copy of the fusion protein on their surface and therefore favors the formation of dimers of the binding protein on the surface of the gene package.

Each of the fusion protein monomers may be prepared in the context of an oligomer, such that the portion of soluble linking agents is less than 20%, more preferably less than 10%, most preferably less than 1%.

A genetic package displaying at least two fusion proteins may preferably be prepared. In a specific example, each monomer of the oligomer is attached to the outer surface of the genetic package. The disclosure also provides bivalent phages displaying two oligomer fusion proteins, each of which contains an oligomer that dimerizes upon expression.

A library according to the claims may be provided which may comprise by way of example at least 10 variant genetic packages, wherein said variant genetic packages may exhibit heteromers of modular antibody domains.

The target binding site and the scaffold binding site may be similar or identical. The scaffold ligand is selected from the group consisting of CD64, CD16, CD32, Fc receptors, FcRn, serum albumin, Protein A, Protein G, and Protein L.

The library may also contain variants of the oligomer produced according to the invention that have differences in amino acid sequence.

This may be provided by modifying the amino acid sequences by at least one insertion or substitution to introduce at least one foreign amino acid, and by a deletion. Foreign amino acids may be introduced by a randomization technique. Foreign amino acids may also be selected from a specific amino acid pool to obtain a library enriched for specific amino acids at the randomized positions. When the foreign amino acid is selected from a specific amino acid pool, such as amino acids with specific polarity, or hydrophobicity, a library enriched for the specific amino acid pool at the randomized positions may be obtained according to the invention. Such libraries are also called "focused" libraries.

Also described herein is a method of selecting a linker for attachment of a polypeptide to the external surface of a genetic package, comprising:

a. providing a genetic package library containing various linkers for connecting a first polypeptide to the genetic package,

b. determining the member of the library that contains a linker that does not significantly interfere with the function of said first polypeptide, and

c. selecting said linker to connect a second polypeptide to said genetic package.

In this way, suitable linkers can be obtained to be used for fusion proteins of the same type. The same type of fusion proteins refers to those that link the same genetic package formats and linking agent to each other.

Such a method can further be used to prepare enriched libraries containing a preselected set of linker variants that meet at least one selection criterion, such as flexibility and steric accessibility of the binding site to the linker partner. This can be determined by measuring the binding properties of a well-known linker in the presence of various linker sequences. The enriched library can thus be further selected for another criterion, such as protease resistance, which is, for example, important for stability in a medium containing bacterial proteases.

The selected specific linker sequence can then be used to prepare fusion protein libraries of the same format, however, with variants of the binding agents, thus allowing the identification, selection and preparation of those agents with the best binding properties in predetermined test systems.

Such a linker may be at least 20 amino acids long, preferably at least 25 amino acid residues, more preferably at least 30 amino acid residues, up to 50 amino acid residues. Especially, when amino acids such as Gly, Ser or Ala, which are responsible for the flexibility of a linker, are involved, such a linker is advantageously used for the presentation of a possible binding site, which is close to the surface of the genetic package and which possible binding site may not be able to bind its component for steric reasons.

The linker between the protein to be displayed and the anchor protein of the genetic package (in case of filamentous phage, e.g. p3, p8, pX, pIX, pVII) is especially important if the potential binding site of the displayed molecule is in spatial proximity to the phage particle. In antibody libraries using variable domains and antigen binding sites formed by CDR loops and display of library members as amino-terminal fusion with p3, the potential antigen binding site is directed away from the phage particle. Therefore, the linker structure between library members and the phage coat protein is not important. Manipulating the lower loops of immunoglobulin domains and performing phage display can, however, be an inefficient process and decrease the yields of antigen-binding clones or even discard them. Varying the linker between a library member protein and its surface fusion component can solve or at least reduce this problem.

In order to select optimal linker sequences (in terms of length and flexibility as well as stability), a linker library can be prepared in which the anchor protein on the surface of the replicable genetic package is fused to a known binding protein that is, for steric reasons, notoriously difficult to select.

Linker library screening methods for optimal linkers depend on the application, but should basically be to select for all properties that are desired in a given methodology. Enrichment against an antigen that is difficult to select may yield linker sequences that allow library members good access to the antigen. Incubation in protease solutions or under other stringent conditions or frequent passage through host cells under proteolytic conditions (e.g., aged microbial cultures) may be appropriate screening for stable presentation linkers.

A library of linkers can be produced by any well-known library technology. Synthetic linker sequence lengths can vary between 10-500 amino acids. Alternatively, the linker can be complete proteins known to be flexible in nature.

Also described herein is a method of producing an oligomer of modular antibody domains that bind to a target comprising the steps of:

- provide a library of modular antibody domain oligomers produced as described,

- contacting said library with said target in the presence of a scaffold ligand,

- selecting a library member that binds to said target in the presence of a scaffold ligand, and

- manufacturing a preparation of the functional oligomer as set forth in claim 1.

The scaffold ligand may be selected from the group consisting of an effector molecule, FcRn, serum albumin, protein A, protein G, protein L, or a CDR target. As an example, the effector molecule may be selected from the group consisting of CD64, CD16, CD32, Fc receptors.

Oligomers may be dimers selected from the group of VH/VL, CH1/CL, CH2/CH2, CH3/CH3, Fc and Fab, or individual chains thereof.

The method may provide a library containing at least 102 independent clones expressing functional oligomers of modular antibody domains or variants thereof. The library member may then be selected according to the requested binding affinity, preferably having a target binding affinity of Kd<10-8 M. A preselected set of independent clones, which is matured, for example, by affinity, which set may preferably comprise at least 10, more preferably at least 100, more preferably at least 10000, most preferably at least 10000, even more than 100000 independent clones. Those libraries, containing the preselected sets, are preferred sources for selecting the high affinity modular antibodies according to the invention.

Preferably, the library is a yeast library and the yeast host cell displays on the cell surface the oligomers with the biological activity. The yeast host cell is preferably selected from the genera Saccharomyces, Pichia, Hansenula, Schizosaccharomyces, Kluyveromyces, Yarrowia and Candida. Most preferably, the host cell is Saccharomyces cerevisiae.

The target may be an erbB class receptor. In this case, the described method can be used to obtain an immunoglobulin that binds to an erbB class receptor.

The invention further provides a high quality library containing at least 106 independent clones of functional dimers of modular antibody domains comprising a CH2 domain and a CH3 domain, as set forth in claim 10. The target may be a ligand that binds to a parent molecule subject to amino acid variation. The parent molecule may be a functional Fc or a functional Fab, or part thereof.

Parent molecules can be varied by random or site-specific mutagenesis.

The library may contain functional dimers of modular antibody domains that are binding to a target and a scaffold ligand, and at least 20%, preferably at least 30%, more preferred at least 40% of the functional dimers are binding to CD64. This is particularly preferred with a modular antibody containing CH2 domains, such as an Fc scaffold.

Alternatively, the library may contain functional dimers of modular antibody domains that are binding to a target and a scaffold ligand, and at least 20%, preferably at least 30%, more preferred at least 40% of the functional dimers are binding to protein A. This is particularly preferred with a modular antibody containing both CH2 and CH3 domains, such as an Fc scaffold.

Figures:

Figure 1:

Schematic presentation of the PCRs used for the production of the fragments used for the assembly of the Fcab01 library. The PCR primers are indicated by arrows with their respective 5'-3' orientation, and the vertical lines indicate the approximate positions of the introduced restriction sites that were used for the assembly of the mutated gene. The restriction sites are contained in the primers for ligations of the PCR fragments.

Figure 2:

Amino acid sequence and secondary structure of a CH3 domain (IMGT numbering). The randomization scheme is provided for libraries Fcab01 to Fcab06.

Randomized positions in the AB and EF loop are marked with a circle. X represents the 20 amino acids (encoded by NNB), z for Ala, Asp, Ser, Tyr only (encoded by KMT; centered library).

Detailed description of the invention

The oligomers of the modular antibody domains described herein will be useful as stand-alone molecules, as well as fusion proteins or derivatives, most typically fused before or after modification such that they are part of larger structures, e.g., whole antibody molecules, or parts thereof. The immunoglobulins or fusion proteins described herein also comprise Fc fragments, Fab fragments, Fv fragments, single domain antibodies, in particular single domain Fv fragments, bi- or multispecific scFvs, diabodies, unibodies, multibodies, multivalent or multimers of immunoglobulin domains and others. It will be possible to use the engineered proteins to produce molecules that are monospecific, bispecific, trispecific, and may even carry further specificities. It is possible to control and preselect the binding valency at the same time according to the requirements of the intended use of such molecules.

Specific terms as used throughout this specification have the following meanings.

The term "immunoglobulin" is defined as polypeptides or proteins which may exhibit mono-, bi- or multi-specific binding properties, or mono-, bi- or multivalent, preferably at least two, more preferred at least three specific binding sites for epitopes of, for example, antigens, effector molecules or proteins of both pathogenic and human structure origin, such as autoantigens including cell-associated or serum proteins. The term immunoglobulin also includes functional fragments of an antibody, such as Fc, Fab, scFv, single chain dimers of CH1/CL domains, Fv, dimers such as VH/VL, CH1/CL, CH2/CH2, CH3/CH3, or other derivatives or combinations of the immunoglobulins, such as single chains of immunoglobulin domain pairs. The definition also includes domains of the heavy and light chains of the variable region (such as dAb, Fd, V1, Vk, Vh, VHH) and the constant region or individual domains of an intact antibody such as CH1, CH2, CH3, CH4, Cl and Ck, as well as mini-domains consisting of at least two beta strands of an immunoglobulin domain connected by a structural loop.

"Modular antibodies" are defined as antigen-binding molecules, such as human antibodies, composed of at least one polypeptide module or protein domain, preferably in the native form. The term "modular antibodies" includes antigen-binding molecules that are either immunoglobulins, immunoglobulin-like proteins, or other proteins exhibiting modular formats and antigen-binding properties similar to immunoglobulins or antibodies, which can be used as antigen-binding scaffolds, preferably based on human proteins.

The term "immunoglobulin-like molecule" refers to any antigen-binding protein, in particular a human protein, that has a domain structure that may be constructed in a modular manner. Immunoglobulin-like molecules include T-cell receptors (TCRs), fibronectin, transferrin, CTLA-4, single-chain antigen receptors, e.g. those related to T-cell receptors and antibodies, antibody mimetics, adnectins, anticalins, filomers, repeat proteins such as ankyrin repeats, avimers, VersabodiesTM, scorpion toxin-based molecules, and other non-antibody protein scaffolds with antigen-binding properties.

Ankyrin repeat (AR), armadillo repeat (ARM), leucine-rich repeat (LRR), and tetratricopeptide repeat (TPR) proteins are the most important members of the repeat protein class of proteins. Repeat proteins are composed of homologous structural units (repeats) that stack to form elongated domains. The binding interaction is typically mediated by several adjacent repeats, leading to large target interaction surfaces.

Abimers contain multi-domain rope-like A domains in several cell surface receptors. Domains from this family naturally bind to 100 different known targets, including small molecules, proteins, and viruses. Truncation analysis has shown that a target is typically contacted by multiple A domains with each domain binding independently to a unique epitope. The avidity generated by combining multiple binding domains is a powerful approach to increase affinity and specificity, which these receptors have exploited during evolution.

Anticalins are engineered human proteins derived from the lipocalin scaffold with defined binding properties typical for humanized antibodies. Lipocalins comprise 160-180 amino acids and form conical beta-barrel proteins with a ligand-binding pocket surrounded by four loops. Small hydrophobic compounds are the natural ligands of lipocalins, and different lipocalin variants with novel compound specificities (also called 'anticalins') could be isolated after randomizing residues in this binding pocket.

Single-chain or single-domain antigen receptors contain a single variable domain and are 20% smaller than camelid single-domain antibodies.

Phyllomeres are peptides derived from fragments of biodiverse natural proteins.

The term "modular antibody", "immunoglobulin", "immunoglobulin-like proteins" is understood to include a derivative thereof as well. A derivative is any combination of one or more antibodies and or a fusion protein in which any domain or minidomain of the modular antibody can be fused at any position of one or more other proteins (such as other modular antibodies, immunoglobulins, ligands, scaffold proteins, enzymes, toxins and the like). A derivative of the modular antibody can also be obtained by association or attachment to other substances by various chemical techniques such as covalent coupling, electrostatic interaction, disulfide bonding, etc. The other substances attached to the immunoglobulins can be lipids, carbohydrates, nucleic acids, organic and inorganic molecules, or any combination thereof (e.g., PEG, prodrugs or drugs). A derivative would also comprise an antibody with the same amino acid sequence, but made entirely or partially of non-natural or chemically modified amino acids.

A "structural loop" or "non-CDR loop" is to be understood as follows: Modular antibodies, immunoglobulins or immunoglobulin-like substances are made of domains with a so-called immunoglobulin fold. In essence, antiparallel beta-sheet strands are connected by loops to form a compressed antiparallel beta-barrel. In the variable region, some of the loops of the domains essentially contribute to the specificity of the antibody, i.e. the binding to an antigen by the natural binding site of an antibody. These loops are called CDR loops. The CDR loops are located within the CDR loop region, which in some cases may also include the variable structural region (called "VFR") that is adjacent to the CDR loops. It is known that VFRs can contribute to the antigen-binding pocket of an antibody, which is usually determined primarily by the CDR loops. Thus, those VFRs are considered to be part of the CDR loop region, and would not be appropriately used to engineer new antigen binding sites. In contrast to those VFRs within the CDR loop region or located proximal to the CDR loops, other variable domain VFRs would be particularly suitable. These are the structural loops of VFRs located opposite the CDR loop region, or on the C-terminal side of a variable immunoglobulin domain.

The term "antigen" or "target" shall in particular include all antigens and target molecules capable of being recognized by a binding site of a modular antibody. Specifically preferred antigens are those antigens or molecules, which have already been shown to be or are capable of being immunologically or therapeutically relevant, especially those for which a clinical efficacy has been proven.

The term "target" or "antigen" as used herein shall comprise molecules selected from the group consisting of allergens, tumor associated antigens, auto-antigens including cell surface receptors, enzymes, Fc receptors, FcRn, HSA, IgG, interleukins or cytokines, complement system proteins, transport proteins, serum molecules, bacterial antigens, fungal antigens, protozoan antigens and viral antigens, also molecules responsible for transmissible spongiform encephalitis (TSE), such as prions, infective or not, and markers or molecules referring to inflammatory conditions, such as proinflammatory factors, multiple sclerosis or Alzheimer's disease, or even haptens.

The term "cell surface antigens" shall include all antigens capable of being recognized by an antibody structure on the surface of a cell, and fragments of such molecules. Preferred cell surface antigens are those antigens, which have already been shown to be or are capable of being immunologically or therapeutically relevant, especially those for which preclinical or clinical efficacy has been proven. Those cell surface molecules are capable of mediating cell killing activity. Upon binding of the immunoglobulin to preferably at least two of those cell surface molecules, the immune system provides cytolysis or cell death, thus providing a potent means of attacking human cells.

The antigen is recognized either as a complete target molecule or as a fragment of such a molecule, especially substructures of targets, generally called epitopes.

Antigen substructures are generally referred to as "epitopes" (e.g. B-cell epitopes, T-cell epitopes), as they are immunologically relevant, i.e. they are also recognizable by natural or monoclonal antibodies. The term "epitope" as used herein shall mean a molecular structure that may completely constitute a specific binding partner or be part of a specific binding partner at a binding site of a modular antibody or an immunoglobulin. The term epitope may also refer to haptens. Chemically, an epitope may be composed of a carbohydrate, a peptide, a fatty acid, an organic, biochemical or inorganic substance, derivatives thereof and any combination thereof. If an epitope is a polypeptide, it will typically include at least 3 amino acids, preferably 8 to 50 amino acids, and more preferably between about 10-20 amino acids in the peptide. There is no critical upper limit to the length of the peptide, which could comprise almost the entire length of a polypeptide sequence of a protein. Epitopes may be either linear or conformational epitopes. A linear epitope comprises a single segment of a primary sequence of a polypeptide chain. Linear epitopes may be contiguous or overlapping. Conformational epitopes comprise amino acids brought together by folding of the polypeptide to form a tertiary structure and the amino acids are not necessarily adjacent to each other in the linear sequence. Specifically, epitopes are at least part of diagnostically relevant molecules, i.e. the absence or presence of an epitope in a sample is qualitatively or quantitatively related to either a disease or health status of a patient or to process status in manufacturing or to environmental or dietary status. Epitopes can also be at least part of therapeutically relevant molecules, i.e. molecules that can be targeted by the specific binding domain that changes the course of the disease.

As used herein, the term "specifically binds to" or "specific binding" refers to a binding reaction that is determinative of the cognate ligand of interest in a heterogeneous population of molecules. Thus, under designated conditions (e.g., immunoassay conditions), the modular antibody binds to its particular target and does not bind in significant amount to other molecules present in a sample. Specific binding means that the binding is selective in terms of target identity, high, medium, or low binding affinity or avidity, as selected. Selective binding is typically achieved if the binding constant or binding dynamics is at least 10-fold different, preferably the difference is at least 100-fold, and more preferred at least 1000-fold.

The term "expression system" refers to nucleic acid molecules containing a desired coding sequence and control sequences in operable linkage such that hosts transformed or transfected with these sequences are capable of producing the encoded proteins. In order to effect transformation, the expression system may be included in a vector; however, the relevant DNA may also be integrated into the host chromosome. Alternatively, an expression system for in vitro transcription/translation may be used. The expression system may employ a host cell that is either a eukaryotic or prokaryotic host cell, such as a mammalian or yeast host cell, as well as a bacterial host cell.

An expression system for fusion proteins is a non-suppressor host cell, which would be sensitive to a stop codon, such as an amber stop codon, and thus would stop translation thereafter. In the absence of such a stop codon, such non-suppressor host cells, preferably E. coli, are preferably used. In the presence of such a stop codon, suppressor host cells would be used.

All immunoglobulin amino acid sequence numbering is according to the IMGT numbering scheme (IMGT, the international ImMunoGeneTics, Lefranc et al., 1999, Nucleic Acids Res. 27: 209–212).

The term "binding agent" or "ligand" refers to a member of a binding pair, in particular binding polypeptides that have the potential to serve as a binding domain for a binding partner. Examples of binding partners include pairs of binding agents with functional interactions, such as a receptor that binds ligands, an antibody that binds antigen or receptors, a drug that binds a target, and an enzyme that binds a substrate.

The term "fusion protein" or "chimeric fusion protein" shall mean the molecule composed of a genetic package, at least part of an external surface structure, such as a coat protein or part thereof, optionally a linker sequence, and a binding agent. The fusion protein is encoded by a vector with the binding agent gene and information for presenting a copy of the binding agent on the surface of the genetic package.

The term "cytotoxic activity" shall mean activity on effector cells resulting in activation of cytotoxic T cells or on cells, which mediate antibody-dependent cellular cytotoxicity (ADCC), complement-dependent cytotoxicity (CDC) and/or antibody-dependent cellular phagocytosis (ADCP). Modular antibodies thus kill antibody-coated target cells, which optionally bind to their Fc receptors.

"Scaffold" shall mean a temporary natural or artificial structural region used to support the molecular structure of a polypeptide in the construction of variants or a repertoire of the polypeptide. It is typically a modular system of polypeptide domains that maintains the tertiary structure or function of the parent molecule. Exemplary scaffolds are modular antibodies, which can be mutagenized to produce variants within such a scaffold, to obtain a library.

The term "scaffold ligand" shall mean a ligand that binds to a scaffold or the backbone of modular antibodies, thereby determining the molecular structure or primary function and specificity of said modular antibody. In preferred instances, the scaffold ligand is a functional ligand, which mediates a biological function upon binding, such as an effector ligand. In an alternative embodiment, the scaffold ligand is a functional ligand, which is a specific target bound by the CDR region, nonstructural loop region, or structural loop region. The same scaffold ligand may bind to many variants of a modular antibody regardless of their target specificities. In general, the presence of the scaffold ligand binding site indicates that the variant is correctly expressed and folded. Thus, binding of the scaffold ligand to its binding site provides a method of preselecting functional polypeptides from a repertoire of polypeptides. The design of modular antibody variants that retain the property of binding to a scaffold ligand avoids the preparation of variants that are non-functional, for example as a result of the introduction of mutations, folding mutants or expression mutants that would or are incapable of binding to substantially any target or effector ligand. Such non-functional mutants are sometimes generated by the normal randomization and variation procedures employed in the construction of polypeptide repertoires. Providing functional mutants that bind to a scaffold ligand enables one of skill in the art to prepare a modular antibody library that is enriched for functional, well-folded and highly expressed library members.

The term "effector ligand" should mean a ligand that mediates effector functions, such as an effector molecule. Exemplary effector ligands are Fc receptors or Fc receptor-like molecules that interfere with immunoglobulins. An Fc receptor is a protein found on the surface of certain cells - including natural killer cells, macrophages, neutrophils, and mast cells - that contribute to the protective functions of the immune system. Its name is derived from its binding specificity for a portion of an antibody known as the Fc (fragment crystallizable) region. Fc receptors bind to antibodies that are bound to infected cells or invading pathogens. Their activity stimulates phagocytic or cytotoxic cells to destroy microbes, or infected cells by antibody-mediated cellular phagocytosis (ADCP) or antibody-dependent cellular cytotoxicity (ADCC). There are several different types of Fc receptors, which are classified based on the type of antibody they recognize; those that bind the most common class of antibody, IgG, are called Fc-gamma receptors (F<cy>R), those that bind IgA are called Fc-alpha receptors (FcaR), and those that bind IgE are called Fc-epsilon receptors (FcsR). Equivalent to an effector ligand and so incorporated into the definition is any surrogate ligand that recognizes the same or similar binding site within the modular antibody, such as protein A.

All F<cy>Rs belong to the immunoglobulin superfamily and are the most important Fc receptors for inducing phagocytosis of opsonized (coated) microbes. This family includes several members that differ in their antibody affinities due to their different molecular structure: F<cy>RI (CD64), F<cy>RIIA (CD32a), F<cy>RIIB (CD32b), FcyRIIIA (CD16a), FcyRIIIB (CD16b. For example, FcyRI binds IgG more strongly than FcyRII and FcyRIII, and has an extracellular portion composed of three immunoglobulin (Ig)-like domains, one more domain than FcyRII and FcyRIII. These properties allow activation of FcyRI by a single IgG molecule (or monomer), whereas the latter two Fcy receptors must bind multiple IgG molecules within an immune complex to be activated.

Another FcR is expressed on multiple cell types and is similar in structure to the MHC class I receptor. This receptor also binds IgG and is involved in preserving this antibody in order to increase its biological half-life in vivo. However, since this Fc receptor is also involved in transferring IgG from a mother both via the placenta to her fetus and in milk to her infant, it is called the neonatal Fc receptor (FcRn). Recently, this receptor has been implicated in the homeostasis of serum IgG levels.

Antibody-dependent cellular cytotoxicity (ADCC) is a mechanism of cellular immunity by which an effector cell of the immune system actively lyses a target cell that has been bound by specific antibodies. It is one of the mechanisms by which antibodies, as part of the humoral immune response, can act to limit and contain infection. Classical ADCC is mediated by natural killer (NK) cells; monocytes and eosinophils can also mediate ADCC. For example, eosinophils can kill certain parasitic worms known as helminths by ADCC. ADCC is part of the adaptive immune response because of its dependence on a prior antibody response.

The term "foreign" in the context of amino acids shall mean newly introduced amino acids that are naturally occurring but foreign to the modification site, or substitutes for naturally occurring amino acids. "Foreign", with reference to an antigen-binding site, means that the antigen-binding site is not naturally formed by the specific binding region of the agent, and a foreign binding component, but not the natural binding component of the agent, is bound by the newly engineered binding site.

The term "variable binding region", sometimes called "CDR region" as used herein, refers to molecules with variable structures capable of binding interactions with antigens. Such molecules may be used as such or integrated within a larger protein, thus forming a specific region of such protein with binding function. Variable structures may be derived from natural repertoires of binding proteins such as immunoglobulins or filomers or synthetic diversity, including repeat proteins, avimers or anticalins. Variable structures may also be produced by randomization techniques, in particular those described herein. These include mutagenized or non-mutagenized CDR regions of CDRs, variable domain loop regions of immunoglobulins or constant domains.

Modified binding agents with different modifications at specific sites are called "variants". Variants of a framework are preferably pooled to form libraries of binding agents, which can be used to select library members with predetermined functions. Accordingly, a loop region of a binding agent comprising positions within one or more loops possibly contributing to a binding site is preferably mutated or modified to produce libraries, preferably by random, semi-random or, in particular, by random site-directed mutagenesis methods, in particular to delete, exchange or introduce randomly generated inserts into loops, preferably into structural loops. Alternatively, the use of combinatorial approaches is preferred. Any of the known mutagenesis methods may be employed, among them cassette mutagenesis. These methods can be used to make amino acid modifications at desired positions in the immunoglobulin. In some cases, positions are chosen randomly, for example with either any of the possible amino acids or a selection of preferred amino acids to randomize loop sequences, or amino acid changes are made using simple rules. For example, all residues may be preferentially mutated to specific amino acids, such as alanine, referred to as amino acid scanning or alanine scanning. Such methods can be coupled with more sophisticated engineering approaches that employ selection methods to screen for higher levels of sequence diversity.

Cytotoxic modular antibody with molecular weight below 60 kD or up to 60 kD having a small molecular weight compared to full length antibodies. The preferred size is up to 55 kD. Individual domains of modular antibody typically have a molecular size of 10-15 kD, thus a molecule based on 4 modular antibody domains would have a molecular size of 40-60 kD, depending on glycosylation or any additional conjugation of pharmacologically active substances, such as toxins or peptides.

The preferred format is an oligomer, composed of modular antibody domains, preferably up to 4 domains, more preferred 3 domains, and even more preferred consisting of 2 domains. It is commonly believed that formats based on the combination of 5 modular antibody domains or more do not exert the specific advantages of small-sized antibody fragments, which are, for example, ease of expression in various expression systems and tissue penetration.

It is feasible to provide a modular antibody as a single domain antibody. However, antibody domains tend to dimerize upon expression, either as a homodimer, such as an Fc, or as a heterodimer, such as a Fab. Thus, the dimeric structure is considered as a basis for the preferred stable molecule. Immunoglobulin domain dimers include single domains, such as VH/VL, CH1/CL (kappa or lambda), CH2/CH2, and CH3/CH3. Dimers or oligomers of modular antibody domains can also be provided as single-chain or double-chain molecules, particularly those that link the C-terminus of one domain to the N-terminus of another.

Binding partners are agents that bind specifically to each other, usually through non-covalent interactions. Examples of binding partners include pairs of binding agents with functional interactions, such as a receptor that binds ligands, an antibody that binds antigens, a drug that binds a target, and an enzyme that binds a substrate. Binding partners have found use in many therapeutic, diagnostic, analytical, and industrial applications. The most important binding partners, also called binding pairs, are antibodies or immunoglobulins, fragments, or derivatives thereof. In most cases, binding of such binding agents is required to mediate a biological effect or function, a "functional interaction."

A binding agent may be an immunoglobulin of human or murine origin, and may be used for various purposes, in particular in pharmaceutical compositions. Of course, the modified immunoglobulin may also be a humanized or chimeric immunoglobulin.

The binding agent which is a human immunoglobulin is preferably selected or derived from the group consisting of IgA1, IgA2, IgD, IgE, IgG1, IgG2, IgG3, IgG4 and IgM. The murine immunoglobulin binding agent is preferably selected or derived from the group consisting of IgA, IgD, IgE, IgG1, IgG2A, IgG2B, IgG2C, IgG3 and IgM.

Such a binding agent preferably comprises a heavy and/or light chain or a portion thereof. A modified immunoglobulin may comprise a heavy and/or light chain, at least one variable and/or constant domain, or a portion thereof including a minidomain.

A constant domain is an immunoglobulin folding unit of the constant part of an immunoglobulin molecule, also called a constant region domain (e.g., CH1, CH2, CH3, CH4, Ck, Cl).

A variable domain is an immunoglobulin folding unit of the variable part of an immunoglobulin, also called a variable region domain (e.g., Vh, Vk, Vl, Vd)

An exemplary modular antibody consists of a constant domain selected from the group consisting of CH1, CH2, CH3, CH4, Igk-C, Igl-C, combinations, derivatives or a part thereof, including a mini-domain, with at least one loop region, and is characterized in that said at least one loop region comprises at least one amino acid modification forming at least one modified loop region, wherein said at least one modified loop region specifically binds to at least one epitope of an antigen.

Another modular antibody may consist of a variable domain of a heavy or light chain, combinations, derivatives or a part thereof, including a minidomain, with at least one loop region, and is characterized in that said at least one loop region comprises at least one amino acid modification forming at least one modified loop region, wherein said at least one modified loop region specifically binds to at least one epitope of an antigen.

The modular antibody may comprise one or more domains (e.g. at least two, three, four, five, six, ten domains). If more than one domain is present in the modular antibody, these domains may be of the same type or of variable types (e.g. CH1-CH1-CH2, CH3-CH3, (CH2)2-(CH3)2, with or without the hinge region). Of course, also the order of the individual domains may be of any kind (e.g. CH1-CH3-CH2, CH4-CH1-CH3-CH2).

Described herein are parts of antibodies, such as IgG, IgA, IgM, IgD, IgE and the like. Modular antibodies may also be a functional antibody fragment such as Fab, Fab<2>, scFv, Fv, Fc, Fcab™, an antigen-binding Fc, or parts thereof, or other derivatives or combinations of the immunoglobulins such as minibodies, variable region heavy and light chain domains (such as dAb, Fd (binding site made up of one or more individual domains), VL, including Vlambda (Vl) and Vkappa (Vk), VH, VHH) as well as mini-domains consisting of two beta strands of an immunoglobulin domain connected by at least two structural loops, as isolated domains or in the context of naturally associated molecules.

Described herein is the Fc fragment of an antibody molecule, either as an antigen-binding Fc fragment (Fcab™) through amino acid sequence modifications or as conjugates or fusions with receptors, peptides or other antigen-binding modules, such as scFv.

Modular antibodies may be used as isolated polypeptides or as combination molecules, for example by recombination, fusion or conjugation techniques, with other peptides or polypeptides. The peptides are preferably homologous to immunoglobulin domain sequences, and are preferably at least 5 amino acids in length, more preferably at least 10 or even at least 50 or 100 amino acids in length, and constitute at least partially the loop region of the immunoglobulin domain. Preferred binding characteristics relate to predefined epitope binding, affinity and avidity.

The modular antibody is possibly further combined with one or more modified modular antibodies or with unmodified modular antibodies, or parts thereof, to obtain a combination modular antibody. Combinations are preferably obtained by recombination techniques, but also by linking by adsorption, electrostatic interactions or the like, or even by conjugation or chemical bonding with or without a linker. The preferred linker sequence is either a natural linker sequence or a functionally suitable artificial sequence.

In general, the modular antibody can be used as a structural element to molecularly combine other modular antibodies or biologically active substances or molecules. It is preferred to molecularly combine at least one antibody that binds to the specific component via the variable or non-variable sequences, such as structural loops, with at least one other binding molecule that may be an antibody, antibody fragment, a soluble receptor, a ligand or other antibody domain, or a binding moiety thereof. Other combinations relate to proteinaceous molecules, nucleic acids, lipids, organic molecules and carbohydrates.

The engineered molecules described herein will be useful as stand-alone proteins, as well as fusion proteins or derivatives, most typically fused such that they are part of larger antibody structures or complete antibody molecules, or parts or fragments thereof, such as Fab fragments, Fc fragments, Fv fragments and others. It will be possible to use the engineered proteins to produce molecules that are monospecific, bispecific, trispecific, and may even carry more specificities at the same time, and it will be possible to simultaneously control and preselect the binding valency according to the intended use requirements of such molecules.

The modular antibody optionally exerts one or more antigen binding regions, including the binding site that specifically binds to the target cell surface and the binding sites that mediate the effector function. Antigen binding sites to one or more antigens may be presented by the CDR region or any other natural receptor binding structure, or introduced into a structural loop region of an antibody domain, either of a variable or constant domain structure. Antigens, as used to test the binding properties of the binding sites, may be naturally occurring molecules or chemically synthesized molecules or recombinant molecules, either in solution or in suspension, for example located on or in particles such as solid phases, on or in cells or on viral surfaces. It is preferred that the binding of an immunoglobulin to an antigen is determined when the antigen is still attached or bound to molecules and structures in the natural context. Thus it is possible to identify and obtain those modified immunoglobulins that are best suited for the purpose of diagnostic or therapeutic use.

The modular antibody or immunoglobulin domains may be modified (as used herein, the terms immunoglobulin and antibody are interchangeable), which modifications are preferably made to immunoglobulin domains or portions thereof that contain a loop, either a CDR loop or a non-CDR loop, which structural loops are preferred sites of modifications or mutagenesis. In some cases it is preferable to use a defined modified structural loop or structural loop region, or portions thereof, as isolated molecules for binding or combination purposes.

It is particularly preferred that the modulating antibody binds to said target cell surface via at least part of a structural loop and/or CDR loop.

The modular antibody may bind to said effector ligand, or a surrogate ligand for an effector ligand such as protein A, via at least part of a structural loop and/or CDR loop, thereby mediating effector function.

In a preferred embodiment, the binding agent binds with its native binding structure or modified structure or newly formed binding site, specifically to at least two such epitopes that are identical or differ from each other, both from the same antigen and from different antigens.

In a preferred domain structure of a binding agent it is preferred to modify at least one loop region by causing a substitution, deletion and/or insertion of one or more nucleotides or amino acids, preferably a point mutation, or even the exchange of entire loops, more preferred the change of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15, up to 30 amino acids. Thus, the modified sequence comprises amino acids not included in the conserved regions of the loops, the newly introduced amino acids being naturally occurring but foreign to the site of modification, or substitutes for naturally occurring amino acids.

However, the maximum number of amino acids inserted into a loop region of a binding agent may preferably not exceed the number of 30, preferably 25, more preferably 20 amino acids at most. The substitution and insertion of amino acids preferably occurs randomly or semi-randomly using all possible amino acids or a selection of preferred amino acids for randomization purposes, by methods known in the art and as disclosed in the present patent application.

The modification site may be in a specific single loop or a loop region, in particular a structural loop or a structural loop region. A loop region is typically composed of at least one, preferably at least two, preferably at least 3 or at least 4 loops which are at the tip or at the bottom of a domain, in proximity or adjacent to each other, and which can contribute to the binding of an antigen by forming an antigen binding site or antigen binding pocket. It is preferred that the one or more modification sites are located within the area of 10 amino acids, more preferably within 20, 30, 40, 50, 60, 70, 80, 90 up to 100 amino acids, in particular within a structural region to form a surface or pocket where the antigen can sterically access the loop regions.

In this regard, preferred modifications are manipulated in the loop regions of CH1, CH2, CH3 and CH4, in particular in the range of amino acids 7 to 21, amino acids 25 to 39, amino acids 41 to 81, amino acids 83 to 85, amino acids 89 to 103 and amino acids 106 to 117.

A modification of the structural loop region comprising amino acids 92 to 98 can be combined with a modification in the structural loop region comprising amino acids 8 to 20.

The above-identified amino acid regions of the respective immunoglobulins comprise loop regions to be modified. Preferably, a modification in the structural loop region comprising amino acids 92 to 98 is combined with a modification in one or more of the other structural loops.

A modification in the structural loop region comprising amino acids 92 to 98 can be combined with a modification in the structural loop region comprising amino acids 41 to 45.2.

Each of the structural loops comprising amino acids 92 to 98, amino acids 41 to 45.2, and amino acids 8 to 20 may contain at least one amino acid modification.

Each of the structural loops comprising amino acids 92 to 98, amino acids 41 to 45.2, and amino acids 8 to 20 may contain at least one amino acid modification.

Amino acid residues in the area of CH3 positions 15 to 17, 29 to 34, 41 to 45.2, 84 to 85, 92 to 100, and/or 108 to 115 can be modified.

Modifications of Igk-C and Igl-C of human origin can be engineered in the loop regions in the area of amino acids 8 to 20, amino acids 26 to 36, amino acids 41 to 82, amino acids 83 to 88, amino acids 92 to 100, amino acids 107 to 124, and amino acids 123 to 126.

Modifications of the loop regions of Igk-C and Igl-C of murine origin can be engineered at sites in the area of amino acids 8 to 20, amino acids 26 to 36, amino acids 43 to 79, amino acids 83 to 85, amino acids 90 to 101, amino acids 108 to 116, and amino acids 122 to 126.

An immunoglobulin used as a therapeutic described herein may consist of a variable domain of a heavy or light chain, or a part thereof, including a minidomain, with at least one loop region, preferably a structural loop region, and is characterized in that said at least one loop region comprises at least one amino acid modification forming at least one modified loop region, wherein said at least one modified loop region forms a relevant binding site as described above.

The immunoglobulin may contain a modification within the variable domain, which is selected from the group of VH, Vkappa, Vlambda, VHH and combinations thereof. More specifically, they comprise at least one modification within amino acids 7 to 22, amino acids 39 to 55, amino acids 66 to 79, amino acids 77 to 89 or amino acids 89 to 104, where the amino acid position numbering of the domains is that of IMGT.

The immunoglobulin may be characterized in that the human-derived VH or Vkappa or Vlambda loop regions comprise at least one modification within amino acids 7 to 22, amino acids 43 to 51, amino acids 67 to 77, amino acids 77 to 88, and amino acids 89 to 104, most preferably amino acid positions 12 to 17, amino acid positions 45 to 50, amino acid positions 68 to 77, amino acids 79 to 88, and amino acid positions 92 to 99, wherein the amino acid position numbering of the domains is that of IMGT.

The structural loop regions of the variable domain of immunoglobulin of human origin, as possible selected for modification purposes, can be located in the area of amino acids 8 to 20, amino acids 44 to 50, amino acids 67 to 76, amino acids 78 to 87 and amino acids 89 to 101.

The structural loop regions of the variable domain of the murine immunoglobulin selected for modification purposes can be located in the area of amino acids 6 to 20, amino acids 43 to 52, amino acids 67 to 79, amino acids 79 to 87 and amino acids 91 to 100.

Immunoglobulin can be of camelid origin. Camel antibodies comprise only one heavy chain and have the same affinity for antigen as normal antibodies consisting of light and heavy chains. Consequently, camel antibodies are much smaller than, for example, human antibodies, which enables them to penetrate dense tissues to reach the antigen, where larger proteins cannot. Furthermore, the comparative simplicity, high affinity and specificity, and the possibility to reach and interact with active sites, make camel heavy chain antibodies advantageous over common antibodies in the design, production, and application of clinically valuable compounds.

The structural loop regions of a modular antibody or immunoglobulin of camelid origin may be modified, for example within a VHH, in the region of amino acids 7 to 19, amino acids 43 to 55, amino acids 68 to 76, amino acids 80 to 87 and amino acids 91 to 101.

A method of producing a modular antibody as disclosed herein may relate to engineering a modular antibody that specifically binds to at least one first epitope and that comprises modifications in each of at least two structural loop regions, and determining the specific binding of said at least two loop regions to at least one second epitope, wherein the unmodified structural loop region (non-CDR region) does not specifically bind to said at least one second epitope. Thus, an antibody or antigen binding structure specific for a first antigen may be improved by adding another valency or specificity against a second antigen, which specificity may be identical, whether directed to different epitopes or to the same epitope, to increase the valency or to obtain bi-, oligo- or multi-specific molecules.

On the other hand, it is preferred to use those modular antibodies that contain native structures that interact with effector molecules or immune cells. These native structures either remain unchanged or are modulated for a high effector function. It is described that binding sites for, for example, Fc receptors are located in a CH2 and/or CH3 domain region, and can be mutagenized by well-known techniques.

ADCC, antibody-dependent cellular cytotoxicity, is the killing of antibody-coated target cells by cells with Fc receptors that recognize the constant region of the bound antibody. Most ADCC is mediated by NK cells that have the Fc receptor FcgammaRIII or CD16 on their surface. Typical assays employ target cells, such as Ramos cells, incubated with serially diluted antibody prior to the addition of freshly isolated effector cells. The ADCC assay is then further incubated for several hours and the % cytotoxicity is detected. Typically the target:effector ratio is approximately 1:16, but can be 1:1 to 1:50. Complement-dependent cytotoxicity (CDC) is a mechanism of cell killing in which antibody bound to the target cell surface fixes complement, resulting in the assembly of the membrane attack complex that punches holes in the target cell membrane resulting in subsequent cell lysis. The commonly used CDC assay follows the same procedure as for ADCC determination, however, with serum-containing complement instead of effector cells.

Cytotoxic activity as determined by any ADCC and CDC assay demonstrates for a modulating antibody if there is a significant increase in the percentage of cytolysis compared to a control. The absolute percentage increase is preferably greater than 5%, more preferably greater than 10%, even more preferred greater than 20%.

Antibody-dependent cellular phagocytosis, ADCP, sometimes called ADPC, is usually investigated in conjunction with cytolysis of cultured human cells. Phagocytosis by phagocytes, usually human monocytes or monocyte-derived macrophages, as mediated by an antibody can be determined as follows. Purified monocytes can be cultured with cytokines to enhance FcyR expression or to induce differentiation into macrophages. ADCP and ADCC assays are then performed with target cells. Phagocytosis is determined as the percentage of positive cells as measured by flow cytometry. ADCP-positive activity is demonstrated by significant uptake of the antibody-antigen complex by the phagocytes. The absolute percentage is preferably greater than 5%, more preferably greater than 10%, even more preferred greater than 20%.

In a typical assay, PBMCs or monocytes or monocyte-derived macrophages are resuspended in RF2 medium (RPMI 1640 supplemented with 2% FCS) in 96-well plates at a concentration of 1 x 10 viable cells in 100 ml/well. Appropriate target cells, expressing the target antigen, e.g. Her2/neu antigen and SKBR3 cells, are stained with PKH2 green fluorescent dye. Subsequently, 1 x 10 PKH2-labeled target cells and a Her 2-specific antibody (IgG1) (or modular antibody) or mouse IgG1 isotype control (or modular antibody control) are added to the PBMC well at different concentrations (e.g. 1-100 pg/ml) and incubated in a final volume of 200 ml at 37 °C for 24 h. After incubation, PBMCs or monocytes or monocyte-derived macrophages and target cells are harvested with EDTA-PBS and transferred to 96-well V-bottom plates. Plates are centrifuged and the supernatant is aspirated. Cells are counterstained with a 100 µl mixture of RPE-conjugated anti-CD11b, anti-CD14 and human IgG, mixed and incubated for 60 min on ice. Cells are washed and fixed with 2% formaldehyde-PBS. Two-color flow cytometry analysis is performed with, for example, a FACS Calibur under optimal regulation. PKH2-labeled target cells (green) are detected in channel FL-1 (emission wavelength, 530 nm) and RPE-labeled PBMCs or monocytes/monocyte-derived macrophages (red) are detected in channel FL-2 (emission wavelength, 575 nm). Residual target cells are defined as cells that are PKH2+/RPE-. Doubly-labeled cells (PKH2+/RPE-) are considered to represent phagocytosis of targets by PBMCs or monocytes/monocyte-derived macrophages. Target cell phagocytosis is calculated using the following equation: percentage phagocytosis = 100 x [(percentage double positives)/(percentage double positives - percentage residual targets)]. All tests are typically performed in duplicate or triplicate and results are expressed as mean 6 SD.

The effector function of the modular antibody is usually distinguished from any synthetic cytotoxic activity, for example by a toxin that can be conjugated to an immunoglobulin structure. Toxins do not normally activate effector molecules and the biological defense mechanism. Thus, the preferred cytotoxic activity of modular antibodies is a biological cytotoxic activity, which is usually immunostimulatory, leading to effective cytolysis.

The modular antibody may specifically bind to any type of binding molecules or structures, in particular to antigens, proteinaceous molecules, proteins, peptides, polypeptides, nucleic acids, glycans, carbohydrates, lipids, organic molecules, in particular small organic molecules, inorganic molecules, or combinations or fusions thereof, including PEG, prodrugs or drugs. The modular antibody may comprise at least two loops or loop regions whereby each of the loops or loop regions may specifically bind to different molecules or epitopes.

Preferably, the target antigen is selected from cell surface antigens, including receptors, in particular from the group consisting of erbB receptor tyrosine kinases (such as EGFR, HER2, HER3 and HER4, in particular those epitopes of the extracellular domains of such receptors, for example the 4D5 epitope), molecules of the TNF receptor superfamily, such as the Apo-1 receptor, TNFR1, TNFR2, nerve growth factor receptor NGFR, CD40, cell surface T molecules, T cell receptors, T cell antigen OX40, TACI receptor, BCMA, Apo-3, DR4, DR5, DR6, decoy receptors, such as DcR1, DcR2, CAR1, HVEM, GIt R, ZTNFR-5, NTR-1, Tn Fl 1, but not limited to these molecules, antigens ... surface of B lymphocytes, such as CD10, CD19, CD20, CD21, CD22, antigens or markers of solid tumors or hematologic cancer cells, lymphoma or leukemia cells, other blood cells including blood platelets, but not limited to these molecules.

According to another preferred embodiment, the target antigen is selected from those antigens presented by cells, such as epithelial cells, solid tumor cells, infected cells, blood cells, antigen-presenting cells and mononuclear cells. Those target antigens expressed or overexpressed by cells are preferably targeted, which are selected from the group consisting of tumor-associated antigens, in particular EpCAM, tumor-associated glycoprotein-72 (TAG-72), tumor-associated antigen CA 125, prostate-specific membrane antigen (PSMA), high molecular weight melanoma-associated antigen (HMW-MAA), tumor-associated antigen expressing the Lewis Y-related carbohydrate, carcinoembryonic antigen (CEA), CEACAM5, HMFG PEM, mucin MUC1, MUC18 and cytokeratin tumor-associated antigen, bacterial antigens, viral antigens, allergens, allergy-related molecules IgE, cKIT and Fc-epsilon-receptor I, IRp60, IL-5 receptor, CCR3, red blood cell receptor (CR1), human serum albumin, mouse serum albumin, rat serum albumin, erythrocyte sedimentation rate (ESR), ... Fc, such as neonatal Fc-gamma receptor FcRn, Fc-gamma receptors Fc-gamma RI, Fc-gamma-RII, Fc-gamma RIII, Fc-alpha receptors, Fcepsilon receptors, fluorescein, lysozyme, toll-like receptor 9, erythropoietin, CD2, CD3, CD3E, CD4, CD11, CD11a, CD14, CD16, CD18, 19, CD20, CD22, CD23, CD25, CD28, CD29, CD30, CD32, CD33 (p67 protein), CD38, CD40, CD40L, CD52, CD54, CD56, CD64, CD80, CD147, GD3, IL-1, IL-1 R, IL-2, IL-2R, IL-4, IL-5, IL-6, IL-6R, IL-8, IL-12, IL-15, IL-17, IL-18, IL-23, LIF, OSM, interferon alpha, interferon beta, interferon gamma; TNF-alpha, TNFbeta2, TNFalpha, TNFalfabeta, TNF-R1, TNF-RII, FasL, CD27L, CD30L, 4-1BBL, TRAIL, RANKL, TWEAK, APRIL, BAFF, LIGHT, VEG1, OX40L, TRAIL receptor-1, adenosine A1 receptor, lymphotoxin beta receptor, TACI, BAFF-R, EPO; LFA-3, ICAM-1, ICAM-3, beta1 integrin, beta2 integrin, alfa4/beta7 integrin, alfa2 integrin, alfa3 integrin, alfa4 integrin, alfa5 integrin, alfa6 integrin, alfav integrin, alfaVbeta3 integrin, FGFR-3, keratinocyte growth factor, GM-CSF, M-CSF, RANKL, VLA-1, VLA-4, L-selectin, anti-Id, ina, HLA, HLA-DR, CTLA-4, T cell receptor, B7-1, B7-2, V<n>R integrin, TGFbeta1, TGFbeta2, eotaxin 1, BlyS (B cell stimulator), complementC5, IgE, IgA, IgD, IgM, IgG, factor VII, c Bl , NCA 90, EGFR (ErbB-1), Her2/neu (ErbB-2), Her3 (ErbB-3), Her4 (ErbB4), tissue factor, VEGF, VEGFR, endothelin receptor, VLA-4, carbohydrates such as blood group antigens and related carbohydrates, galiliglycation, gastrin, gastrin receptors, tumor-associated carbohydrates, hapten NP-cap or NIP-cap, T-cell receptor alpha/beta, E-selectin, P-glycoprotein, MRP3, MRP5, glutathione-S-transferase pi (multi-drug resistance proteins), alpha-granule membrane protein (GMP) 140, digoxin, placental alkaline phosphatase (PLAP) and testicular PLAP-like alkaline phosphatase, transferrin receptor, heparanase I, human cardiac myosin, glycoprotein IIb/IIIa (GPIIb/IIIa), human cytomegalovirus (HCMV) gH envelope glycoprotein, HIV gp120, HCMV, respiratory syncytial virus RSV F, RSVF Fgp, VNR integrin, Hep B gp120, CMV, gpIIbIIIa, HIV gp120 IIIB V3 loop, respiratory syncytial virus (RSV) Fgp, herpes simplex virus (HSV) gD glycoprotein, HSV gB glycoprotein, HCMV gB envelope glycoprotein, Clostridium perfringens toxin, and fragments thereof.

Modular antibodies can bind to said target antigen with high affinity, in particular with a high and/or low association constant, or a high binding avidity. Typically, a binder is considered to be a high affinity binder with a Kd of <10-9 M. Medium affinity binders with a Kd of less than 10-6 up to 10-9 for example can also be provided in conjunction with an affinity maturation process.

Affinity maturation is the process by which antibodies with high affinity for antigen are produced. Upon structural changes to an antibody, including amino acid mutagenesis or as a consequence of somatic mutation in immunoglobulin gene segments, variants of an antigen binding site are produced and selected for higher affinities. Affinity-matured modular antibodies may have several log-fold higher affinity than a parent antibody. Individual parent antibodies may be subjected to affinity maturation. Alternatively, sets of modular antibodies with similar binding affinity for the target antigen may be considered parent structures that are varied to obtain individual affinity-matured antibodies or affinity-matured sets of such antibodies.

The affinity matured variant of a modular antibody may exhibit at least a 10-fold increase in binding affinity, preferably at least a 100-fold increase. Affinity maturation may be employed in the course of screening campaigns employing respective libraries of parent molecules, either with modular antibodies having medium binding affinity to obtain a modular antibody having the target-specific binding property of a Kd<10-8 M and/or a potency of IC<50><10-8 M. Alternatively, the binding potency or affinity may be raised even further by affinity maturation of the modular antibody according to the invention to obtain the high values corresponding to a Kd or IC<50>of less than 10-9 M, preferably less than 10-10 M or even less than 10-11 M, most preferably in the picomolar range.

The IC<50>, also called the 50% saturation concentration, is a measure of the binding potency of a modular antibody. It is the molar concentration of a ligand, which produces 50% of the maximal binding possible at equilibrium or under saturation. The potency of an antagonist is usually defined by its IC<50> value. This can be calculated for a given antagonist by determining the concentration of antagonist required to elicit half-saturation of the maximal binding of an agonist. Elucidating an IC<50> value is useful for comparing the potency of antibodies or antibody variants with similar efficacies; however, the dose-response curves produced by both drug antagonists should be similar. The lower the IC<50>, the greater the potency of the antagonist, and the lower the concentration of drug required to inhibit the maximal biological response, such as effector function or cytotoxic activity. Lower drug concentrations may also be associated with fewer side effects.

The affinity of an antibody usually correlates well with the IC<50>. The affinity of an antagonist for its binding site (Ki) is understood as its ability to bind to a receptor, which determines the duration of binding and the respective agonist activity. Measures to increase the affinity by affinity maturation usually also increase the binding potency, resulting in the respective reduction of IC<50> values in the same range of Kd values.

IC<50> and Kd values can be determined using saturation binding assays well known in the art.

The modular antibody may be conjugated to a label or reporter molecule, selected from the group consisting of organic molecules, enzymatic labels, radioactive labels, colored labels, fluorescent labels, chromogenic labels, luminescent labels, haptens, digoxigenin, biotin, metal complexes, metals, colloidal gold, and mixtures thereof. Modified immunoglobulins conjugated to labels or reporter molecules may be used, for example, in assay systems or diagnostic methods.

The modular antibody can be conjugated to other molecules that allow for simple detection of said conjugate in, for example, binding assays (e.g., ELISA) and binding studies.

Antibody variants may be screened using one or more cell-based or in vivo assays. For such assays, purified or unpurified modified immunoglobulins are typically added exogenously so that cells are exposed to individual immunoglobulins or pools of immunoglobulins belonging to a library. These assays are typically, but not always, based on immunoglobulin function; that is, the ability of the antibody to bind to its target and mediate some biochemical event, e.g., effector function, inhibition of ligand/receptor binding, apoptosis, and the like. Such assays frequently involve monitoring the response of cells to the antibody, e.g., cell survival, cell death, change in cell morphology, or transcriptional activation such as cellular expression of a wild-type gene or reporter gene. For example, such assays may measure the ability of antibody variants to elicit ADCC, ADCP, or CDC. For some assays it may be necessary to add additional cells or components, which is in addition to the target cells, for example, serum complement, or effector cells such as peripheral blood monocytes (PBMCs), NK cells, macrophages, and the like. Such additional cells can be from any organism, preferably human, mouse, rat, rabbit, and monkey. Modular antibodies can cause apoptosis of certain cell lines expressing the target, or can mediate the attack on target cells by immune cells that have been added to the assay. Methods of monitoring cell death or viability are known in the art, and include the use of dyes, immunochemical, cytochemical, and radioactive reagents. For example, caspase staining assays can allow apoptosis to be measured, and the uptake or release of radioactive substrates or fluorescent dyes such as Alamar blue can allow cell growth or activation to be monitored.

The EuTDA-based cytotoxicity assay DELFIART (Perkin Elmer, MA) can be used. Alternatively, dead or damaged target cells can be monitored by measuring the release of one or more natural intracellular components, e.g. lactate dehydrogenase.

Transcriptional activation can also serve as a method to assay function in cell-based assays. In this case, the response can be monitored by assaying genes or natural immunoglobulins that can be upregulated, for example the release of certain interleukins can be measured, or alternatively the readout can be by a reporter construct. Cell-based assays can also involve the measurement of morphological changes of cells in response to the presence of modular antibodies. Cell types for such assays can be prokaryotic or eukaryotic, and various cell lines known in the art can be employed. Alternatively, cell-based screens are performed using cells that have been transformed or transfected with nucleic acids encoding the variants. That is, antibody variants are not exogenously added to the cells. For example, cell-based screening can utilize cell surface display. A fusion component can be used that allows the presentation of modified immunoglobulins on the surface of cells (Wittrup, 2001, Curr Opin Biotechnol, 12:395-399).

The immunogenicity of modular antibodies can be determined experimentally using one or more cell-based assays. Ex vivo activation of T-cell assays can be used to experimentally quantify immunogenicity. In this method, antigen-presenting cells and intact donor T cells are exposed one or more times to a peptide or whole antibody of interest. T-cell activation can then be detected using a variety of methods, for example by monitoring cytokine production or measuring tritiated thymidine uptake.

Interferon gamma production can be monitored using Elispot assays.

The biological properties of the modular antibody may be characterized ex vivo in cell, tissue, and whole organism experiments. As is known in the art, drugs are frequently tested in vivo in animals, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and monkeys, in order to measure the efficacy of a drug for treatment against a disease or disease model, or to measure a drug's pharmacokinetics, pharmacodynamics, toxicity, and other properties. Animals may be referred to as disease models. Therapeutics are frequently tested in mice, including, but not limited to, nude mice, SCID mice, xenograft mice, and transgenic mice (including knock-in and knock-out). Such experimentation can provide significant data for determining the potential of the antibody to be used as a therapeutic with the appropriate half-life, effector function, apoptotic activity, cytotoxic or cytolytic activity. Any organism, preferably mammals, may be used for testing. For example, due to their genetic similarity to humans, primates, monkeys may be suitable therapeutic models, and thus may be used to test the efficacy, toxicity, pharmacokinetics, pharmacodynamics, half-life, or other property of the modular antibody according to the invention. Testing of the substances in humans is ultimately required for approval as drugs, and so such experiments are of course contemplated. Thus, the modular antibodies described herein may be tested in humans to determine their therapeutic efficacy, toxicity, immunogenicity, pharmacokinetics, and/or other clinical properties. Especially those modular antibodies that bind to a single cell or a cell complex via at least two binding motifs, preferably binding of at least three-fold cross-linking target cells, would be considered effective in effector activity or pre-apoptotic or apoptotic activity following cell targeting and cross-linking. Multivalent binding provides a relatively large association of binding partners, also called cross-linking, which is a prerequisite for apoptosis and cell death.

The modular antibody described herein may find use in a wide range of antibody products. The modular antibody may be used for therapy or prophylaxis, for example as active or passive immunotherapy, for preparative, industrial or analytical use, as a diagnostic, an industrial compound or a research reagent, preferably a therapeutic. The modular antibody may find use in an antibody composition that is monoclonal or polyclonal. The modular antibodies may be used to capture or destroy target cells carrying the target antigen, for example cancer cells. The modular antibodies may be used to block, antagonize or agonize the target antigen, for example by antagonizing a cytokine or cytokine receptor.

Modular antibodies can be used to block, antagonize or agonize growth factors or growth factor receptors and thus mediate the destruction of target cells carrying or requiring the target antigen.

Modular antibodies can be used to block, antagonize or agonize enzymes and enzyme substrates.

A modular antibody described herein can be administered to a patient to treat a specific disorder. A “patient” includes both humans and other animals, preferably mammals, and most preferably humans. By “specific disorder” herein is meant a disorder that can be ameliorated by administration of a pharmaceutical composition comprising a modified immunoglobulin described herein.

In one example, a modular antibody may be the sole therapeutically active agent administered to a patient. Alternatively, the modular antibody may be administered in combination with one or more other therapeutic agents, including, but not limited to, cytotoxic agents, chemotherapeutic agents, cytokines, growth inhibitory agents, antihormonal agents, kinase inhibitors, antiangiogenic agents, cardioprotectants, or other therapeutic agents. The modular antibody may be administered concomitantly with one or more other therapeutic regimens. For example, a modular antibody may be administered to the patient in conjunction with chemotherapy, radiation therapy, or both chemotherapy and radiation therapy. In one embodiment, the modular antibody may be administered in conjunction with one or more antibodies, which may or may not comprise a modular antibody as disclosed herein. In another example, the modular antibody and one or more other anticancer therapies are employed to treat cancer cells ex vivo. It is contemplated that such ex vivo treatment may be useful in bone marrow transplantation and particularly autologous bone marrow transplantation. Of course, it is envisaged that antibodies can be used in combination with still other therapeutic techniques such as surgery.

Various other therapeutic agents may find use for administration with the modular antibody. In one example, the modular antibody may be administered with an anti-angiogenic agent, which is a compound that blocks, or interferes to some degree with, the development of blood vessels. The anti-angiogenic factor may be, for example, a small molecule or protein, for example an antibody, Fc fusion molecule, or cytokine, that binds to a growth factor or growth factor receptor involved in promoting angiogenesis. The preferred anti-angiogenic factor herein is an antibody that binds to vascular endothelial growth factor (VEGF). In an alternative example, the modular antibody may be administered with a therapeutic agent that induces or enhances the adaptive immune response, for example an antibody that targets CTLA-4. The modified immunoglobulin may be administered with a tyrosine kinase inhibitor, which is a molecule that inhibits in some way the tyrosine kinase activity of a tyrosine kinase. In an alternative example, the modular antibody is administered with a cytokine. By "cytokine" as used herein is meant a generic term for proteins released by one cell population that act on another cell as intercellular mediators including chemokines.

Pharmaceutical compositions are contemplated in which modular antibodies and one or more therapeutically active agents are formulated. Stable formulations of the modular antibodies disclosed herein are prepared for storage by mixing said immunoglobulin having the desired degree of purity with optional pharmaceutically acceptable carriers, excipients or stabilizers, in the form of lyophilized formulations or aqueous solutions. Formulations to be used for in vivo administration are preferably sterile. This is readily accomplished by filtration through sterile filtration membranes or other methods. The modular antibody and other therapeutically active agents disclosed herein may also be formulated as immunoliposomes, and/or entrapped in microcapsules.

Administration of the pharmaceutical composition comprising a modular antibody disclosed herein, preferably in the form of a sterile aqueous solution, may be done in a variety of ways, including, but not limited to, orally, subcutaneously, intravenously, intranasally, intraotically, transdermally, mucosally, topically (e.g., gels, balms, lotions, creams, etc.), intraperitoneally, intramuscularly, intrapulmonarily (e.g., commercially available AERx™ inhalable technology from Aradigm, or commercially available Inhance™ pulmonary delivery system from Inhale Therapeutics), vaginally, parenterally, rectally, or intraocularly.

Also described herein is a randomly modified nucleic acid molecule encoding an immunoglobulin, immunoglobulin domain, or a portion thereof comprising at least one nucleotide repeat unit within a structural loop coding region having the sequence 5'-NNS-3', 5'-NNN-3', 5'-NNB-3', or 5'-NNK-3'. In some examples, the modified nucleic acid comprises nucleotide codons selected from the group of TMT, WMT, BMT, RMC, RMG, MRT, SRC, KMT, RST, YMT, MKC, RSA, RRC, NNK, NNN, NNS, or any combination thereof (encoding is according to IUPAC).

Modification of the nucleic acid molecule can be accomplished by introducing synthetic oligonucleotides into a larger nucleic acid segment or by de novo synthesis of an entire nucleic acid molecule. Nucleic acid synthesis can be accomplished with tri-nucleotide structural elements that would reduce the number of antisense sequence combinations if a subset of amino acids is to be encoded (e.g., Yanez et al. Nucleic Acids Res. (2004) 32:e158; Virnekas et al. Nucleic Acids Res. (1994) 22:5600-5607).

The randomly modified nucleic acid molecule may comprise the above-identified repeat units, which encode all known naturally occurring amino acids or a subset thereof. Those libraries containing modified sequences in which a specific subset of amino acids is used for the purposes of modification are called "focused" libraries. Members of such libraries have a high probability of an amino acid from such a subset at the modified position, which is at least two-fold higher than usual, preferably at least 3-fold or even at least 4-fold higher. Such libraries also have a limited or lower number of library members, such that the number of actual library members reaches the number of theoretical library members. In some cases, the number of library members of a focused library is not less than 10 times the theoretical number, preferably not less than 10 times, most preferably not less than 10 times.

Typically, libraries comprise at least 10 fusion proteins or potential binding agents or scaffold protein variants, preferably at least 100, more preferred at least 1000, more preferred at least 104, more preferred at least 105, more preferred at least 106, more preferred at least 107, more preferred at least 108, more preferred at least 109, more preferred at least 1010, more preferred at least 1011, up to 1012, in cases of in vitro display methods, such as ribosomal display, even higher numbers are feasible.

Libraries according to the invention are set forth in the claims. Various alternatives are available for the manufacture of the gene encoding the randomised library. It is possible to produce the DNA by a completely synthetic approach, in which the sequence is divided into overlapping fragments which are subsequently prepared as synthetic oligonucleotides. These oligonucleotides are mixed together, and hybridised to each other by first heating to approx. 100 °C and then slowly cooling to room temperature. After this hybridisation step, the synthetically assembled gene can either be cloned directly, or it can be amplified by PCR prior to cloning.

Alternatively, other methods for site-directed mutagenesis can be employed for the generation of the insert library, such as the Kunkel method (Kunkel TA. Rapid and efficient site-specific mutagenesis without phenotypic selection. Proc Natl Acad Sci USA. 1985 Jan;82(2):488-92) or the Dpnl method (Weiner MP, Costa GL, Schoettlin W, Cline J, Mathur E, Bauer JC. Site-directed mutagenesis of double-stranded DNA by the polymerase chain reaction. Gene. 1994 Dec 30;151 (1 -2):119-23.).

For various purposes, it may be advantageous to introduce silent mutations into the sequence encoding the library insert. For example, restriction sites can be introduced that facilitate cloning or modular exchange of parts of the sequence. Another example for the introduction of silent mutations is the ability to "tag" libraries, meaning to give them a specific codon at a selected position, which allows them (or selected clones derived from them), for example, to be recognized during later steps, where, for example, different libraries with different characteristics can be mixed together and used as a mixture in the selection or panning procedure.

Described herein is a method of producing a modular antibody domain oligomer that binds to a target comprising the steps of: providing a library of modular antibody domain oligomers produced according to a method as described, contacting said library with said target in the presence of a scaffold ligand, selecting a library member that binds to said target in the presence of a scaffold ligand, and manufacturing a functional oligomer preparation.

The scaffold ligand may be selected from the group consisting of an effector molecule, FcRn, protein A and CDR target. As an example, the effector molecule may be selected from the group consisting of CD64, CD32, CD16, Fc receptors.

Oligomers may be dimers selected from the group of VH/VL, CH1/CL, CH2/CH2, CH3/CH3, Fc and Fab,, or individual chains thereof.

The method can provide a library containing at least 102 independent clones expressing functional oligomers of modular antibody domains or variants thereof.

Libraries according to the invention comprise at least 102 library members, preferably at least 103, more preferred at least 104, more preferred at least 105, more preferred at least 106 library members, more preferred at least 107, more preferred at least 108, more preferred at least 109, more preferred at least 1010, more preferred at least 1011, up to 1012 library members, preferably derived from a parent molecule, which is a modular antibody functional as a scaffold containing at least one specific function or binding moiety, and derivatives thereof, for engineering a new binding site apart from the original functional binding region of said parent moiety.

Typically, libraries contain variants of the modular antibody, resulting from mutagenesis or randomization techniques. These variants include inactive or non-functional antibodies. Thus, it is preferred that any such libraries be screened with the appropriate assay to determine functional effect. Libraries may comprise at least 102 variants of such modular antibodies, more preferred at least 103, more preferred at least 104, more preferred at least 105, more preferred at least 106, more preferred at least 107, more preferred at least 108, more preferred at least 109, more preferred at least 1010, more preferred at least 1011, up to 1012 variants or more to provide a highly diverse antibody repertoire to select the best suitable binders. Any such synthetic libraries may be generated using mutagenesis methods as disclosed herein.

Preferably, the library is a yeast library and the yeast host cell displays on the cell surface oligomers, or monomers that form oligomers, having biological activity. The yeast host cell is preferably selected from the genera Saccharomyces, Pichia, Hansenula, Schizosaccharomyces, Kluyveromyces, Yarrowia and Candida. Most preferred, the host cell is Pichia or Saccharomyces cerevisiae.

The invention provides a high quality library containing at least 102 independent clones of functional dimers of modular antibody domains as set forth in the claims which are capable of binding to a target and a scaffold ligand. The target may be a ligand which binds to a parent molecule subject to amino acid variation. The parent molecule may be a functional oligomer, in particular a functional Fc, or part thereof.

As is well known in the art, there are various display and selection technologies that can be used for the identification and isolation of proteins with certain characteristics and binding affinities, including, for example, display technologies such as cellular and non-cellular systems, in particular mobilized display. Among the cellular systems, phage display, viral display, display in yeast or other eukaryotic cell, such as mammalian or insect cell display, can be used. Mobilized systems refer to display systems in the soluble form, such as in vitro display systems, including ribosomal display, mRNA display, or nucleic acid display.

Methods for producing and screening antibody variants are well known in the art. General methods for the molecular biology, expression, purification and screening of antibodies are described in Antibody Engineering, edited by Duebel & Kontermann, Springer-Verlag, Heidelberg, 2001; and Hayhurst & Georgiou, 2001, Curr Opin Chem Biol 5:683-689; Maynard & Georgiou, 2000, Annu Rev Biomed Eng 2:339-76.

A library according to the invention may be designed as a dedicated library containing at least 50% specific formats, preferably at least 60%, more preferred at least 70%, more preferred at least 80%, most preferred at least 90%, or those consisting mainly of specific antibody formats. Such a preferred library contains mainly the same type of library members having similar structural features. Specific antibody formats are preferred, so that it is the preferred library according to the invention.

Another important aspect of the invention is that each potential binding domain remains physically associated with the particular DNA or RNA molecule encoding it, and furthermore, fusion proteins oligomerize on the surface of a genetic package to present the binding polypeptide in the native and functional oligomeric structure. Once successful binding domains are identified, the gene can be readily obtained for expression, recombination or further manipulation purposes. The form that this association takes is a "replicable genetic package", such as a virus, cell or spore that replicates and expresses the gene encoding the binding domain, and carries the binding domain to its external surface. Another form is an in vitro replicable genetic package, such as ribosomes, which link the encoding RNA to the translated protein. In ribosome display, the genetic material is replicated by enzymatic amplification with polymerases.

Those cells or viruses or nucleic acid carrying the binding agents that recognize the target molecule are isolated and, if necessary, amplified. The genetic package is preferably the M13 phage, and the protein includes the transport signal from the outer surface of the M13 gene III protein.

Preferably, in the method of the present disclosure, the vector or plasmid of the genetic package is under close control of the transcription regulatory element, and the culture conditions are adjusted such that the amount or number of vector or phagemid particles displaying less than two copies of the fusion protein on the surface of the particle is less than about 20%. More preferably, the amount of vector or phagemid particles displaying less than two copies of the fusion protein is less than 10% of the amount of particles displaying one or more copies of the fusion protein. Most preferably, the amount is less than 1%.

The expression vector may preferably be capable of expressing a binding polypeptide, and may be produced as follows: First, a library of binding polypeptide genes is synthesized by introducing a plurality of polynucleotides encoding different binding sequences. The plurality of polynucleotides may be synthesized in an appropriate amount to be linked in operable combination into a vector that can be propagated to express a fusion protein of said binding polypeptide. Alternatively, the plurality of polynucleotides may also be amplified by polymerase chain reaction to obtain sufficient material for expression. However, this would only be advantageous if the binding polypeptide was encoded by a large polynucleotide sequence, for example longer than 200 base pairs or sometimes longer than 300 base pairs. Thus, a diverse synthetic library is preferably formed, ready to select from said diverse library at least one expression vector capable of producing binding polypeptides having the desired preselected function and binding property, such as specificity.

The foregoing description will be more fully understood with reference to the following examples. Such examples are, however, merely representative of methods of carrying out one or more embodiments of the present invention and should not be read as limiting the scope of the invention, which is as set forth in the claims.

Examples

Example 1: Construction of the non-centered Fcab library (Fcab01) and display on phage surface

The crystal structure of an IgG1 Fc fragment, which is published in the Brookhaven database as entry 10QO.pdb, was used to aid in the design of the Fcab library.

The sequence that was used as a basis for the construction of the Fcab library is given in SEQ ID No. 1. In this sequence, the first amino acid corresponds to Glu 216 of human IgG1 (EU numbering; according to the IMGT database (http://imgt.cines.fr/textes/IMGTrepertoire/Proteins/protein/human/IGH/IGHC/Hu_IGHCallgenes.html; search 25-06-2007), it is the first residue of the hinge region of human IgG1, which is given as: (E)PKSCDKTHTCPPCP) of the hinge region of the heavy constant chain of human IgG1). The second-last residue of SEQ ID No. 1 corresponds to Gly 446 of human IgG 1 (EU numbering; IMGT: residue number 129 of the CH3 domain of human IgG1).

After detailed analysis of the structure of 1oqo.pdb and visual inspection of the residues forming the loops connecting the beta strands, it was decided to randomize residues 144, 145 and 146, which are part of the loop connecting beta strand A-B, in addition to 198,199, 200, 203 and 204, which are part of the loop connecting beta strand E-F of SEQ ID No. 1. In addition to the mutated residues, 5 residues were inserted at residue number 198 of SEQ ID No. 1. In SEQ ID No. 2, the sequence of the library insert of library Fcab01 is given, in which all randomized residue positions, in addition to the 5 inserted residues, are designated with the letter X.

The manipulated gene was produced by a series of PCR reactions using degenerate primers followed by ligation of the resulting PCR products. To facilitate ligation, some of the codons of the nucleotide sequence encoding SEQ ID No. 1 were modified to produce restriction sites without changing the amino acid sequences (silent mutations). For insertion into the cloning vector pHEN1 (Nucleic Acids Res. 1991 Aug 11;19(15):4133-7. Multi-subunit proteins on the surface of filamentous phage: methodologies for displaying antibody (Fab) heavy and light chains. Hoogenboom HR, Griffiths AD, Johnson KS, Chiswell DJ, Hudson P, Winter G.) in frame with the pelB secretion signal, the NcoI restriction site close to the 3' end of the pelB secretion signal was used. For the randomized residues, the codon NNS (IUPAC code, where S stands for nucleotides C and G) was chosen which encodes the 20 naturally occurring amino acids but avoids 2 of the 3 stop codons. Other codons such as, for example, NNB (where B stands for nucleotides T, C and G) can also be used. The manipulated sequence is given as a nucleotide sequence in SEQ ID No. 3. This sequence also includes the restriction sites used for cloning into the phagemid display vector pHEN1, namely an NcoI site at the 5' end and a NotI site at the 3' end.

The sequences of the PCR primers used for assembly of the mutated CH3 domain are given in SEQ ID No.

4 to SEQ ID No. 9.

SEQ ID No.4 (EPKSNCO PCR primer)

ccatggccgagcccaaatcttgtgacaaaactc

SEQ ID No.5 (CH3LSAC PCR primer)

agtcgagctcgtcacgggatggggggcaggg

SEQ ID No.6 (PCR primer CH3CSAC)

gtacgagctcnnsnnsnnscaagtcagcctgacctgcctgg

SEQ ID No.7 (PCR primer CH3CHIN)

tgccaagcttgctgtagaggaagaaggagccg

SEQ ID No.8 (PCR primer CH3RHIN)

tgccaagcttaccgtgnnsnnsnnsaggtggnnsnnsgggaacgtcttctcatgctccg

SEQ ID No.9 (CH3RNOT PCR primer)

agttgcggccgctttacccggagacagggagag

Figure 1 shows a schematic presentation of the PCR fragments generated for the assembly of the mutated gene, and the primers therefore used.

The heavy chain cDNA of the human monoclonal antibody 3D6 (Felgenhauer M, Kohl J, Rüker F. Nucleotide sequences of the cDNAs encoding the V-regions of H- and L-chains of a human mono-clonal antibody specific to HIV-1 -gp41. Nucleic Acids Res. 1990 Aug 25;18(16):4927) was used as a template for PCR reactions. The 3 PCR products were digested with SacI and/or HindIII respectively and ligated together. The ligation product was further digested with NcoI and NotI and ligated into the surface display phagemid vector pHEN1, which had been previously digested with NcoI and NotI. The ligation product was then transformed into E. coli by electroporation. Several selected clones were checked by restriction analysis and DNA sequencing and found to contain the insert as planned, including the correctly inserted randomized sequences. For the following steps of phage preparation, standard protocols were followed. Briefly, the ligation mixture was transformed into E. coli TG1 cells by electroporation. Subsequently, phage particles were rescued from E. coli TG1 cells with the helper phage M13-KO7. Phage particles were then precipitated from the culture supernatant with PEG/NaCl in 2 steps, dissolved in water and used for panning or alternatively stored at minus 80 °C.

Example 2: Construction of the centered Fcab library (Fcab02) and display on phage surfaceAs described in Example 1, an Fcab library was prepared in which the randomized library positions are completely randomized, i.e. they are encoded by a codon such as NNS, NNB, NNK, NNN, or others are used.

For clarity, the meaning of letters such as N, B, S or K is defined by the IUPAC nucleotide ambiguity code, which is given in the following table:

Table 1. IUPAC nucleotide ambiguity code

Symbol Meaning Nucleic acid

A A Adenine

C C Cytosine

G G Guanine

T T Thymine

U U Uracil

M A or C

R A or G

W A o T

S C or G

And C or T

K G or T

V A or C or G

H A or C or T

D A or G or T

B C or G or T

X G or A or T or C

N G or A or T or C

Source: Nomenclature for incompletely specified bases in nucleic acid sequences: recommendations 1984. A Cornish-Bowden, Nucleic Acids Res. May 10, 1985; 13(9): 3021-3030.

These codons given above are designed such that all 20 amino acids are encoded by them. It may be preferable to choose subsets of the possible amino acids. Examples can be found in the literature (Fellouse FA, Li B, Compaan DM, Peden AA, Hymowitz SG, Sidhu SS. Molecular recognition by a binary code. J Mol Biol. 2005 May 20;348(5):1153-62. Epub 2005 Apr 1.; Fellouse FA, Wiesmann C, Sidhu SS. Synthetic antibodies from a four-amino-acid code: a dominant role for tyrosine in antigen recognition. Proc Natl Acad Sci USA. 2004 Aug 24;101(34):12467-72. Epub 2004 Aug 11). Focused libraries can be constructed that, for example, only allow 4 different types of amino acids, for example, using the codon KMT, which encodes the amino acids Ser, Tyr, Ala and Asp.

A centered Fcab library, designated Fcab02, was constructed in the same way as described in Example 1, except that the NNS codons were replaced by KMT codons.

Therefore, the letter "X" in SEQ ID No. 2 now stands for "S, Y, A, and D" (Ser, Tyr, Ala, and Asp) in order to describe the centered Fcab02 library.

Example 3: Construction of a phage surface display library with additional amino acid residues between the library insert (junction component) and p3

In order to investigate the accessibility of the potential binding site of the displayed protein, a binding assay is performed: The phage suspension is reacted with microplates (or immunotubes) coated with the anti-myc mAb 9E10. After washing, bound phages are detected with the anti-M13 enzyme conjugate. As a control, helper phage - which do not display the fusion protein and the myc tag - are reacted with the plates. Further controls are reaction of phage with uncoated plates and reaction of phage with antiserum that recognizes the p3 fusion component of the phages.

Ideally, anti-myc reactivity of phage displaying the p3 fusion protein should give very clear ELISA readings, whereas helper phage reactions with anti-myc mAb should not be above background noise (uncoated plates). The structure of a CH3 dimer displayed on the surface of an M13 phage by binding to protein III as an anchor is such that each CH3 is anchored to protein III using various linker lengths and compositions. Thus, the CH3 dimer is preferably displayed by two anchors.

Connector Optimization:

The linker between the protein to be displayed and the anchor protein of the genetic package (in case of filamentous phage, e.g. p3, p8, pX, pIX, pVII) is especially important if the potential binding site of the displayed molecule is in the spatial proximity of the phage particle. In antibody libraries using variable domains and antigen binding sites formed by CDR loops and display of library members as amino-terminal fusion with p3, the potential antigen binding site is directed away from the phage particle. Therefore, the linker structure between library members and the phage coat protein is less important. Manipulating the lower loops of immunoglobulin domains and performing phage display can, however, be an inefficient process and decrease the yields of antigen-binding clones or even discard them. Varying the linker between a library member protein and its surface fusion component can solve or at least reduce this problem.

In order to select optimal linker sequences (in terms of length and flexibility as well as stability), a linker library can be prepared in which the anchor protein on the surface of the replicable genetic package is fused to a known binding protein that is, for steric reasons, notoriously difficult to select.

This sequence library can vary in length and amino acid content.

Linker library screening methods for optimal linkers depend on the application, but should basically be to select for all properties that are desired in a given methodology. Enrichment against an antigen that is difficult to select may yield linker sequences that allow library members good access to the antigen. Incubation in protease solutions or under other stringent conditions or frequent passage through host cells under proteolytic conditions (e.g., aged microbial cultures) may be appropriate screening for stable presentation linkers.

A library of linkers can be produced by any well-known library technology. Synthetic linker sequence lengths can vary between 10-500 amino acids. Alternatively, the linker can be complete proteins known to be flexible in nature.

Fcab01 for connector optimization:

As an example, the Fcab01 library can be used (as described in Example 1). Originally, this library was cloned into the phagemid display vector pHEN1, using NcoI and NotI restriction sites. When cloned in this way, 18 amino acid residues are between the C-terminal amino acid residue of the Fcab01 library insert and the N-terminal amino acid residue of phage M13 p3. The sequence of this splice region is given in SEQ ID No. 10 SPGKAAAEQKLISEEDLNGAATVES - and is explained as follows: The first 4 residues, SPGK, are the 4 C-terminal residues of the Fcab01 library insert, followed by the amino acid sequence AAA, which are the amino acid residues encoded by the NotI restriction site, followed by the sequence EQKLISEEDL, which is the myc epitope, followed by NGAA, after which there is an amber stop codon, which is translated to glutamine (Q) in amber suppressor strains of E. coli such as TG1. The 4 C-terminal residues of SEQ ID No. 10, TVES, are the 4 N-terminal residues of phage M13 p3 as present in the vector pHEN1.

In order to construct a phage displaying an Fcab insert with a high distance between Fcab (the binding component) and the phage body (the genetic package), 5 additional residues were inserted at the C-terminus of the Fcab insert FcabRGD4, directly upstream of the NotI cloning site, yielding clone FcabRGD4L. FcabRGD4 is an Fcab that has an integrin-binding RGD motif inserted into the EF loop of the CH3 domain and that binds to αvp3-integrin in ELISA. As an increased length linker sequence, the amino acid sequence EGGGS, which occurs 8 times in the M13 phage p3 sequence, was used. The resulting amino acid sequence of FcabRGD4L, as expressed after cloning into pHEN1, is given in SEQ ID No. 11. In SEQ ID No. 11, amino acid residues 198-204 represent the RGD motif, amino acid residue 237 is the C-terminal residue of the Fcab insert, residues 238-242 represent the inserted linker sequence (which is the difference from unmodified pHEN1), which is followed by the myc tag, amber stop codon and the p3 sequence.

For cloning of the construct, the FcabRGD4 sequence was amplified from pHENFcabRGD4 (SEQ ID No. 12) using PCR primers EPKSNCO (SEQ ID No. 4) and CH3rlink actagcggccgcagagccaccaccctccttacccggagacagggagag (SEQ ID No. 13) and cloned via NcoI and NotI restriction sites into the pHEN1 vector. The resulting vector, pHENFcabRGD4L (SEQ ID. No. 14), has the additional linker sequence at nucleotide positions 3057-3071.

The two phagemid vectors, pHENFcabRGD4 and pHENFcabRGD4L, were transformed into E. coli TG1. Phage particles were subsequently rescued from E. coli TG1 cells using the helper phage M13-KO7. Phage particles were then precipitated from culture supernatant with PEG/NaCl in 2 steps, dissolved in water and used for ELISA.

Phage ELISA was performed as follows:

The phage suspension is reacted with αvp3-integrin-coated microplates (or immunotubes). After washing, bound phages are detected with anti-M13-enzyme conjugate. As controls, helper phage - which do not display the fusion protein and the myc tag - are reacted with the plates as well as phage particles carrying wtFcab on their surface. Further controls are reaction of phage with uncoated plates and reaction of phage with antiserum that recognizes the Fcab fusion component of the phages. Phage particles with the increased length linker resulting from pHENFcabRGD4L react more readily with αvp3-integrin than phage particles with the original linker as contained in pHENFcabRGD4, and therefore give a stronger signal in ELISA.

Phage selections can be performed in which phage particles with wtFcab are mixed with small amounts of phage particles carrying both FcabRGD4 and FcabRGD4L. After several rounds (usually 3-5) of panning, phage displaying FcabRGD4L are preferentially selected.

Example 4: Designing Fcab libraries

("Fcab" is a registered trademark of f-star Biotechnologische Forschungs- und Entwicklungsges.m.b.H.)

Design of Fcab libraries (illustrated in Figure 2): Amino acid positions in non-CDR loops of CH3 constant domains of antibodies are considered for randomization. Especially AB, C-D and E-F loops are considered since they are on the domain side. Some of the design criteria for randomization at a certain position are described herein.

Amino acids frequently involved in antigen-antibody interactions are described herein for inclusion in a focused library. Here, the amino acids Ala, Asp, Ser and Tyr are used to design the focused library.

Libraries with limited amino acid usage have been shown to be sufficient to generate binders against virtually any antigen (Sidhu & Fellhouse, NATURE CHEMICAL BIOLOGY VOLUME 2 page 682ff; Koide et al PNAS, volume 104 p6632-6637). The advantage of such limited (or focused) libraries is that they can be completely covered by current technologies. Ideally, the amino acid usage reflects a natural amino acid utilization of ligand-receptor binding. However, even libraries using only 2 amino acids (tyrosine and serine) have been reported to give good screening results (in terms of frequency of binders against different binders and in terms of affinity).

Loop Flexibility:

Certain loop structures may be required by the scaffold protein in order to maintain the overall native structure. Randomization of many amino acid positions in loops and even elongation of loops can be facilitated by constructing certain sequences either on one or both sides of the randomized positions. These sequences may be flexible sequences in order to allow for compensating for any tension with certain library sequences at such a position.

Table 2: Example Fcab™ libraries, centered and non-centered

Library Fcab01 is described in the examples above. The sequence space of the focused library designs Fcab02, Fcab04, and Fcab06 is covered by the actual bacterial library sizes of approximately 10e9. In contrast, the fully randomized libraries Fcab01, Fcab03, and Fcab05 are actually severely underrepresented.

Example 5: Cloning of yeast display libraries by homologous recombination

Vector

pYD1 (Invitrogen) is used as the basic vector. The vector is modified as follows, in order to eliminate an XhoI site: pYD1 is cleaved with XhoI, treated with Klenow fragment of DNA polymerase and religated. The resulting sequence is given in pYD1dX (SEQ ID No. 15).

pYD1dX contains a unique BamHI restriction site at position 921/925 and a unique NotI restriction site at position 963/967. It is opened with both of these restriction enzymes.

An insert encoding human IgG1 CH1-hinge-CH2-CH3 is made by PCR from cDNA encoding the heavy chain of a human IgG1 monoclonal antibody. Into this insert, a point mutation is introduced using standard procedures to mutate the C-terminal cysteine residue of the CH1 domain to a serine. The insert is amplified using PCR primers that were attached to a BamHI and Not restriction site at both ends respectively. These restriction sites are then used to clone the insert into pYD1dX to give the display vector pYD1dXFc (SEQ Id No.16). The mutated codon at the C-terminus of the CH1 domain (Cys to Ser) is at positions 1233-1235 in the pYD1DxFc sequence. The stop codon of the insert is at position 1917/1919.

This vector is used as a positive control for the presentation of human CH1-hinge-CH2-CH3 on the yeast surface and as a starting point for the construction of the pYD1CH12 vector (see below).

Cloning libraries

Cloning of libraries in which mutations are introduced into structural loops of CH3 domains is performed in yeast by homologous recombination (gap repair). For this purpose, a recipient vector lacking the CH3 domain is prepared: pYD1dXFc is cleaved with XhoI (position 1603/1607) and NotI (position 1921/1925), the large fragment is prepared by preparative gel electrophoresis, treated with Klenow fragment of DNA polymerase and re-ligated. This procedure reconstitutes a unique XhoI site (position 1603/1607) and gave the vector pYD1 CH12 (SEQ ID No. 17). pYD1 CH12 is subsequently cleaved with XhoI and used as a recipient vector for gap repair in yeast.

As an insert source, the Fcab libraries Fcab01 (SEQ ID No. 18), Fcab02 (SEQ ID No. 19), Fcab03 (SEQ ID No. 20), Fcab04 (SEQ ID No. 21), Fcab05 (SEQ ID No. 22) and Fcab06 (SEQ ID No. 23) are used. These libraries are prepared by standard DNA synthesis and contain randomized residues as well as residues inserted into the AB loop (between residues 359 and 361 (EU numbering)) as well as the EF loop (between residues 413 and 419 (EU numbering)) of the CH3 domain of human IgG1. From this synthetic DNA, the yeast gap repair insert is amplified by PCR using the PCR primer pair gapch35 caacaaggccctgcctgcccccat cgagaagaccatctccaaggccaagggccagcctcgagaaccacaggtgtacaccctgccc (SEQ ID No. 24) and gapfcs3 gagaccgaggagagggttagggataggcttacct tcgaagggccctctagactcgatcgagcggccgctcatttacccggagacagggagagctc ttc (SEQ ID No. 25). 100 µg of XhoI-cleaved pYD1CH12 vector and 100 µg of insert are mixed and transformed into Saccharomyces strain EBY100 (Invitrogen) using the lithium acetate procedure according to the following protocol, which is scaled up by a factor of 100 to transform the required amount of cells and DNA. Briefly, for a single transformation of 1 µg of vector DNA and 1 µg of insert DNA, 10 ml of YPD (2% peptone, 2% dextrose (D-glucose)) is inoculated with one yeast colony and shaken overnight at 30 °C. The OD600 of the overnight culture is determined and the culture is diluted to an OD600 of 0.4 in 50 ml of YPD and grown for an additional 6 h. Cells are pelleted at 2500 rpm and resuspended in 40 ml of distilled water. Cells are pelleted again at 2500 rpm and resuspended in 100 mM LiAc, followed by incubation at 30 °C for 30 minutes. 1 µg of vector DNA, 1 µg of insert, and 50 µl of denatured sheared salmon sperm DNA (2 mg/ml) are mixed with 300 µl of the yeast suspension. 700 µl of a 200 mM Li acetate and 40% PEG-3350 solution are added and mixed with the yeast/DNA suspension, followed by incubation at 30 °C for 30 minutes. 88 µl of DMSO is added, mixed, and the mixture is incubated at 42 °C for 40 minutes, followed by centrifugation in a microfuge for 10 seconds. The supernatant is then removed, the cell pellet is resuspended in 1 ml of distilled water. The pellet is then resuspended in 50-100 µl of TE and plated on minimal dextrose plates containing leucine (10 g/l yeast nitrogen base, 20 g/l dextrose, 0.1 g/l leucine, 15 g/l agar). After incubation of the plates at 30 °C for 2-4 days, single colonies appear and are subsequently picked.

Cultivation - Induction

The harvested yeast libraries (yFcab libraries) are inoculated into 10 mL of SD-CAA medium (10 g/L yeast nitrogen base, 10 g/L casamino acids, 20 g/L dextrose, 0.1 g/L leucine, 9.67 g/L NaH2PO42H2O, and 10.19 g/L Na2HPO47H2O) and grown on a shaker at 250 rpm at 28 °C for 6-8 hours. The OD600 of the culture is determined, and the culture is diluted to an OD600 of 0.2, and grown under the same conditions until an OD600 of 1-2 is reached. Cells are harvested by centrifugation (3000 rpm/5 min/4 °C) and resuspended in SG/R-CAA induction medium (10 g/L yeast nitrogen base, 10 g/L casamino acids, 20 g/L galactose, 10 g/L raffinose, 0.1 g/L leucine, 9.67 g/L NaH2PO4-2H2O and 10.19 g/L Na2HPO4-7H2O). Cultures are induced by incubation for 2 days on a shaker at 250 rpm at 20 °C and subsequently analyzed and sorted.

Quality control of libraries and Fcab.

yFcab libraries are tested for their expression level and quality of expressed Fcab two days after induction with SD-CAA medium. The expression level is tested using a polyclonal anti-human IgG-Fc antiserum (Sigma). For this purpose, 0.5x10e6 library cells are diluted in 1 ml staining buffer (SB), comprising PBS with 2% BSA. Cells are pelleted and stained with 100 µl SB containing 1/2000 diluted anti-human IgG-Fc-PE antiserum (Sigma) for 30 min on ice, washed twice with SB and subsequently analyzed on FACS. Overall, 70%-80% of all cells in each library express Fcab on their cell surface. To test for correct folding of Fcab, protein A staining is performed. Again 0.5x10e6 cells of the library are diluted in 1 ml SB staining buffer, cells are pelleted and stained with 100 µl SB containing 1 µg/ml Prot-A-FITC (Fluka) for 30' on ice, washed twice with SB and subsequently analyzed by FACS. In general, yFcab libraries as described above show >40% ProtA positive cells. In order to test whether Fcabs are expressed as dimers on the cell surface, human CD64 staining is performed. The affinity of CD64 is too low for efficient monomeric binding, therefore CD64 complexes with dimers are used. For this purpose, for example, 1 µg of recombinant CD64 from R&D Systems (containing a HIS tag) is mixed with 1 µg of anti-Penta HIS-Alexafluor 488 (from Qiagen) in 1 ml of SB (total volume). The yFcab libraries are tested for binding to CD64 by incubating the 5x10e5 cells with 100 µl of the complex mixture for 30 min on ice, as a control the cells are incubated with equivalent anti-HIS-Alexafluor 488 alone (1/200 dilution in SB). After incubation the cells are washed twice with ice-cold SB and analyzed on FACS. Overall, >50% of all cells in each library express dimeric Fcabs on their cell surface.

Antigen biotinylation (Her2)

Recombinant antigen, e.g. Her2 (Bendermedsystems), was made using the Pierce EZ link system according to the manufacturer's instructions. Briefly, the antigen is dialyzed against PBS, diluted to 1 mg/ml in PBS and mixed with 10 mM sulfo-LC-LC-biotin (EZ link, Pierce), which was previously dissolved in water. The final ratio of antigen to biotin is 1:3 and the mixture is incubated at room temperature for 30'. The mixture is then "dialyzed" against PBS using Vivaspin MWCO3000 columns (Sartorius) (5x8', 4000 rpm). Finally, the concentration of the biotinylated antigen (Her2) is tested by HPLC and aliquots are stored at -20 °C.

The quality of biotinylated antigen is tested by ELISA. First, plates are coated with anti-Her2 antibody (e.g. Herceptin) at 10 pg/ml in PBS, 100 µl/well overnight at 4 °C, after this the plate is washed 3x with wash buffer (WB) (PBS 0.05% Tween20) and blocked by blocking buffer (BB) (PBS 2% BSA) 1 h at room temperature. After 3x washes with WB, different concentrations of Her2-biotin in 100 µl/well BB are added for 1 h at room temperature, followed by 3x washes with WB. Finally, the plate is incubated with 1:25000 streptavidin-HRP (GE Healthcare) in BB for 1 h at room temperature and washed 3x with WB. Color is developed by adding 100 µl/well of TMB substrate (Sigma), after ~10 minutes the reaction is stopped by adding 100 µl/well of 30% H<2>SO<4>. Results are analyzed with an ELISA reader at 450-630 nm.

Example 6: Production of antigen-specific Fcab (Her2)

Selection of antigen-specific Fcab (Her2) using FACS

First round of selection:

Two days before FACSorting, a yeast library containing 2.5 x 10e8 individual Fcab clones is induced with SG/R-CAA medium to express the Fcabs on their cell surface as described above. After two days, the amount of cells covering, e.g. 10-fold the library (= 2.5 x 10e9), is incubated for 30 min on ice with 500 nM biotinylated antigen (Her2) in 2 ml SB. The cells are then washed once with cold SB and subsequently incubated for 30' on ice with streptavidin-PE (from R&D Systems) diluted 1:100 in SB. The cells are washed twice with ice-cold SB and diluted to a final concentration of 1 x 10e9 cells/ml. Control stains are performed with 5x10e6 cells/ml in 100 µl with streptavidin-PE alone in the absence of antigen. Both the whole library and the control stains are analysed on, for example, a BD FACS ARIA. Control cells are used to set gates for sorting. An FSC/SSC gate (G1) is first set up to identify healthy yeast cells, a plot of FSC width versus FSC area is made in G1 and only non-aggregating cells are selected in a new gate (G2). Cells in G2 are subsequently analysed for streptavidin-PE reactivity using FSC versus FL-2 (PE channel). G3 is set to include 0.1% (false) positive cells. Subsequently, at least 5x10e8 stained cells (twice the library size, ideally more) are screened with the parameters given above and cells in G3 are sorted into a tube containing 2-3 ml SD-CAA medium. Approximately 5x10e5 cells (Pool 1) are harvested in the first round of selection and propagated for 1-2 days, after which cells can be stored at -80°C and aliquots induced to express Fcabs as described above. After a further two days the next round of selection can take place.

Second round of selection:

Pool 1 selected in round 1 is induced to express Fcab on its surface as described above. At least 5x10e6 cells (comprising multiple copies of Pool 1) are incubated for 30' on ice with 500 nM biotinylated antigen (Her2) in 1 ml SB. Cells are then washed once with cold SB and subsequently incubated for 30' on ice with streptavidin-PE (from R&D Systems) diluted 1 in 100 in SB together with 2 pg/ml protein A-FITC (Fluka). Cells are then washed twice with ice-cold SB and diluted to a final concentration of ~2x10e6 cells/ml. In addition, control stainings are done where 5x10e6 cells/ml from Pool 1 in 100 µl of cells are incubated with a mixture of Prot A and streptavidin-PE as above but without incubation with antigen (Her2). Additionally, 5x10e5 cells in 100 µl of a yeast clone expressing non-randomized Fc fragment of wt Fcab is stained with Prot A-FITC as described above in the absence of streptavidin-PE. Cells expressing wt Fcab are analyzed e.g. on a BD FACS ARIA to gate by sorting. First, an FSC/SSC gate (G1) is set up to identify healthy yeast cells, from G1 a plot of FSC width vs. FSC area is made and only non-aggregating cells are selected in the new gate (G2).

Cells in G2 are then analyzed for protein A expression using FSC versus FL-1 (FITC). G3 is established to strongly cover Prot A positive cells (50-60% of parental gate) and G4 is established to weakly cover Prot A positive cells (20-30% of parental cells). G3+G4 will include approximately 70-80% of all cells in G2. Now, cells from the pool stained for streptavidin-PE in the presence of Prot A-FITC are used to establish the rest of the sorting gates. First, G1 and G2 are checked against the cells in the pool and adjusted if necessary. Cells in the pool will have fewer events in G3 and may also be in <g>4, indicating that not all cells in Pool 1 express Fcabs that fold like Fcab-wt. Using the stained control pool cells a new gate is prepared for both G3 and G4. New gates are set up on a FSC and FL-2 (PE) representation. Gate (G5) including 0.1% streptavidin positive (mock) cells in G3 is prepared and the same is done for cells in G4 producing G6. In the next step at least 5x10e6 cells stained for Her2-biotin streptavidin-PE and Prot A-FITC are sorted by FACS-ARIA. Cells are harvested from G5 (Pool 2.1) and G6 (Pool 2.2) into separate tubes containing 2-3 ml of yeast growth medium. Between 10 and 1000 clones can be expected from both gates. Both new pools are propagated for 1-2 days and stored at -80°C. Cells from 2.1 and 2.2 can either be used for further direct sorting in a third round or can be subjected (preferably after mixing the two clones together again) to an additional round of AB loop randomisation (affinity maturation) before being further sorted on FACS.

Affinity maturation for selected clones/sets

For affinity maturation, diversity is introduced into selected clones or sets of selected clones in the AB loop. For this purpose, a PCR was performed with a primer containing degenerate codons at positions 359, 360 and 361 (EU numbering) (Abmut primer, gaaccacaggtgtacaccctgcccccatcccgggatgagctgnnbnnbnnbca ggtcagcctgacctgcc tggtcaaag, SEQ ID No. 26) or alternatively with a primer containing degenerate codons at positions 358, 359, 360,361 and 362 (EU numbering) (Abmut2LR primer, gaaccacaggtgtacaccctgcccccatcccgggatgagnnbnnbnnbnnbnnbgtcagc ctgacctgcctggtcaaag, SEQ ID No. 27). The second primer used in these PCRs is gapfcs3 in both cases. In order to create flanking sequences for efficient gap repair in yeast, the resulting PCR products are further amplified with the primer pair gapch35 and gapfsc3 and subsequently transformed into Saccharomyces cerevisiae strain EBY100 by lithium acetate transformation together with XhoI-cleaved pYD1CH12 as described above. As alternative primers for randomization of the described residues in the AB loop, primers such as Abmut1L (gaaccacaggtgtacaccctgcccccatcccgggatgagnnbnnbnnbnnbcaggtcagc ctgacctgcctggtcaaag, SEQ ID No. 28) or Abmut1R (gaaccacaggtgta caccctgcccccatcccgggatgagctgnnbnnbnnbnnbgtcagcctgacctgcctggtc aaag, SEQ ID No.

29). In an analogous manner, the residues in the EF loop can be randomized, for example, by total randomization or by randomization using enriched oligonucleotides as primers or by similar mutagenesis techniques. The Abmut primer will give 8000 new variants (Set 2.3) from each clone and the Abmut2LR primer will give 3x10e6 new variants (Set 2.4). Thus, Sets 2.3. and 2.4 will both yield new libraries of approximately 10e8 individuals since the starting material (Set 2.1+2.2) already contains approximately 10-1000 clones.

Third round of selection

Affinity-matured Pools 2.3 and 2.4, and if necessary Pool 2.1 (only Prot A-positive cells are preferred), are induced to express Fcabs on their cell surface as described above and subsequently sorted as described for "Second Round of Selection", except that Pools 2.3 and 2.4 are much larger and therefore the staining volumes for the pools are the same as those for the library staining described in "First Round of Selection". In the third round of selection, only Her2-positive/Prot A-positive cells are sorted. Pools derived from these selections typically contain >20% Her2/Prot A-positive cells. If not, then a fourth and fifth (or even more) round(s) of selection combining Prot A with Her2 can be performed.

Clone analysis:

Single clones of pools containing Her2/Prot A cells (>20% preferred) are prepared either by plating the pools onto agar plates containing SD-CAA medium or by sorting single cells (=clones) directly from FACS ARIA onto the plates without generating a pool. Clones are allowed to grow and are transferred to liquid cultures and stored at -80°C. Aliquots of the clones are subsequently induced to express Fcabs on their cell surface as described above and screened for several parameters in FACS. These parameters can be: a dose response range of the antigen used for selection (Her2) with and without the presence of Prot A-FITC, CD64 staining as described above. In addition, using similar staining protocols several irrelevant biotinylated antigens can be screened to identify non-cross-reacting Fcabs.

It is expected that after several rounds of selection for Prot A antigen (Her2) positive cells, a large percentage of clones will show >25% (Her2) antigen positivity when stained with 500 nM (Her2) antigen and >70% Prot A positivity when stained with 2 pg/ml Prot A-FITC. In most cases these clones will also show >50% binding to CD64, thus mimicking the Prot A and CD64 levels of non-randomized Fc fragments (wt Fcab) expressed in yeast.

Selected clones as described above with characteristics as described above are now ready to be produced as soluble molecules. This can be done by transient transfection or by stable transfection of Fcab DNA into new host cells. For this purpose, DNA from individual yeast clones is isolated using conventional procedures. The relevant DNA encoding the complete CH3 domain or only the part of the CH3 domain that is randomized in the library is amplified by PCR and transferred into a new expression vector containing the missing part of Fcab, a suitable promoter and one or more selection markers such as G418, which allows selection of transfected cells out of a pool of non-transfected cells. The new vector is then transiently transfected, for example, into a new host cell such as HEK293 or CHO. The host cells are allowed to recover and subsequently cultured for several days. The culture supernatant will contain soluble Fcab which can be used for further testing with or without purification on, for example, Prot A. Stable cell lines can also be prepared by conventional procedures.

Table 2. Sequences of selected Her2 clones: with reference to Seq.ID No.1 numbering

Claims (10)

1. A library containing at least 102 independent clones of functional dimers of modular antibody domains comprising a CH2 domain and a CH3 domain, said dimers being capable of binding to a target and a scaffold ligand selected from the group consisting of CD64, CD16, CD32, Fc receptors, FcRn, serum albumin, Protein A, Protein G and Protein L, wherein the scaffold ligand binds to the backbone of each dimer independently of the target specificity of the dimer, and wherein binding of the scaffold ligand to the backbone of the dimer indicates that the dimer is correctly expressed and folded, and wherein each dimer comprises an antigen binding site for said target in a structural loop region of either the CH2 domain or the CH3 domain. 2. A library according to claim 1, wherein the scaffold ligand is selected from the group consisting of FcRn, Protein A and Protein G. 3. A library according to claim 1, wherein the scaffold ligand is selected from the group consisting of CD64, CD16, CD32 and Fc receptors. 4. A library according to claim 1, wherein the scaffold ligand is protein A. 5. A library according to claim 1, wherein the scaffold ligand is CD64. 6. A library according to any one of claims 1 to 5, wherein the functional dimers of antibody modular domains are of human origin. 7. A library according to claim 6, wherein the functional dimers of modular antibody domains are derived from human IgG1. 8. A library according to any one of claims 1 to 7, wherein the functional dimers of antibody modular domains are antigen-binding Fc fragments. 9. A library according to any one of claims 1 to 8, wherein the library is a yeast library and the yeast host cell displays on the surface of the cell the functional dimer of modular antibody domains. 10. A library according to any one of claims 1 to 9, wherein the library contains at least 106 independent clones of functional dimers of modular antibody domains including a CH2 domain and a CH3 domain.