US5702891A - HAV probes for use in solution phase sandwich hybridization and assays for detecting the presence of HAV - Google Patents

HAV probes for use in solution phase sandwich hybridization and assays for detecting the presence of HAV Download PDF

Info

Publication number
US5702891A
US5702891A US08/417,476 US41747695A US5702891A US 5702891 A US5702891 A US 5702891A US 41747695 A US41747695 A US 41747695A US 5702891 A US5702891 A US 5702891A
Authority
US
United States
Prior art keywords
segment
nucleic acid
oligonucleotide
hav
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
US08/417,476
Inventor
Janice A. Kolberg
Michael S. Urdea
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Bayer Corp
Original Assignee
Chiron Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Chiron Corp filed Critical Chiron Corp
Priority to US08/417,476 priority Critical patent/US5702891A/en
Application granted granted Critical
Publication of US5702891A publication Critical patent/US5702891A/en
Assigned to CHIRON DIAGNOSTICS CORPORATION reassignment CHIRON DIAGNOSTICS CORPORATION ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: CHIRON CORPORATION
Anticipated expiration legal-status Critical
Expired - Fee Related legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701Specific hybridization probes
    • C12Q1/706Specific hybridization probes for hepatitis
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6816Hybridisation assays characterised by the detection means
    • C12Q1/682Signal amplification
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • This invention is in the field of nucleic acid hybridization assays. More specifically, it relates to novel nucleic acid probes for detecting Hepatitis A Virus (HAV).
  • HAV Hepatitis A Virus
  • Hepatitis A virus is an RNA virus belonging to the picornavirus family and is thought to be responsible for at least 38% of all reported cases of hepatitis. Cohen et al. (J. Virol. 61:50-59, 1987) described the complete nucleotide sequence of wild-type Hepatitis A virus and compared the sequence with laboratory-adapted HAV strains and with other picornaviruses, finding most amino acid differences occurred in the capsid region, whereas most nucleotide differences occurred randomly throughout the genome.
  • EPA 883096976 discloses a variation in the assay described in U.S. Pat. No. 4,868,105, issued 19 Sep. 1989, in which the signal generated by the labeled probes is amplified.
  • the amplification involves the use of nucleic acid multimers. These multimers are branched polynucleotides that are constructed to have a segment that hybridizes specifically to the analyte nucleic acid or to a nucleic acid (branched or linear) that is bound to the analyte and iterations of a second segment that hybridize specifically to the labeled probe.
  • the initial steps of hybridizing the analyte to label or amplifier probe sets and capturing probe sets in a first vessel and transferring the complex to another vessel containing immobilized nucleic acid that will hybridize to a segment of the capturing probes are followed.
  • the multimer is then hybridized to the immobilized complex and the labeled probes in turn hybridized to the second segment iterations on the multimer. Since the multimers provide a large number of sites for label probe attachment, the signal is amplified. Amplifier and capture probe sequences are disclosed for Hepatitis B virus, Neisseria gonorrhoeae, penicillin and tetracycline resistance in N. gonorrhoeae, and Chlamydia trachomatis.
  • One aspect of the invention is a synthetic oligonucleotide useful as an amplifier probe in a sandwich hybridization assay for HAV comprising a first segment having a nucleotide sequence substantially complementary to a segment of HAV nucleic acid, and a second segment having a nucleotide sequence substantially complementary to an oligonucleotide acid multimer.
  • Another aspect of the invention is a synthetic oligonucleotide useful as a capture probe in a sandwich hybridization assay for HAV comprising a first segment having a nucleotide sequence substantially complementary to a segment of HAV nucleic acid; and a second segment having a nucleotide sequence substantially complementary to an oligonucleotide bound to a solid phase.
  • Another aspect of the invention is a solution sandwich hybridization assay for detecting the presence of HAV in a sample, comprising
  • step (b) contacting the product of step (a) under hybridizing conditions with said oligonucleotide bound to the solid phase;
  • step (d) contacting the product of step (c) under hybridization conditions with the nucleic acid multimer, said multimer comprising at least one oligonucleotide unit that is substantially complementary to the second segment of the amplifier probe polynucleotide and a multiplicity of second oligonucleotide units that are substantially complementary to a labeled oligonucleotide;
  • step (f) contacting under hybridizing conditions the solid phase complex product of step (e) with the labeled oligonucleotide;
  • step (h) detecting the presence of label in the solid phase complex product of step (g).
  • kits for the detection of HAV comprising a kit for the detection of HAv in a sample comprising in combination
  • a set of amplifier probe oligonucleotides wherein the amplifier probe oligonucleotide comprises a first segment having a nucleotide sequence substantially complementary to a segment of HAV nucleic acid and a second segment having a nucleotide sequence substantially complementary to an oligonucleotide unit of a nucleic acid multimer;
  • a set of capture probe oligonucleotides wherein the capture probe oligonucleotide comprises a first segment having a nucleotide sequence that is substantially complementary to a segment of HAV nucleic acid and a second segment that is substantially complementary to an oligonucleotide bound to a solid phase;
  • nucleic acid multimer comprising at least one oligonucleotide unit that is substantially complementary to the second segment of the amplifier probe polynucleotide and a multiplicity of second oligonucleotide units that are substantially complementary to a labeled oligonucleotide;
  • Solution phase nucleic acid hybridization assay intends the assay techniques described and claimed in commonly owned U.S. Pat. No. 4,868,105 and EPA 883096976.
  • a “modified nucleotide” intends a nucleotide monomer that may be stably incorporated into a polynucleotide and which has an additional functional group.
  • the modified nucleotide is a 5'-cytidine in which the N 4 -position is modified to provide a functional hydroxy group.
  • An "amplifier multimer” intends a branched polynucleotide that is capable of hybridizing simultaneously directly or indirectly to analyte nucleic acid and to a multiplicity of polynucleotide iterations (i.e., either iterations of another multimer or iterations of a labeled probe).
  • the branching in the multimers is effected through covalent bonds and the multimers are composed of two types of oligonucleotide units that are capable of hybridizing, respectively, to analyte nucleic acid or nucleic acid hybridized to analyte nucleic acid and to a multiplicity of labeled probes.
  • the composition and preparation of such multimers are described in EPA 883096976 and U.S. Ser. No. 558,897 filed 27 Jul. 1990, published as WO92/02526 on 20 Feb. 1992, the disclosures of which are incorporated herein by reference.
  • amplifier probe is intended as a branched or linear polynucleotide that is constructed to have a segment that hybridizes specifically to the analyte nucleic acid and iterations of a second segment that hybridize specifically to an amplifier multimer.
  • capture probe is intended as an oligonucleotide having a segment substantially complementary to a nucleotide sequence of the target DNA and a segment that is substantially complementary to a nucleotide sequence of a solid-phase-immobilized probe.
  • “Large” as used herein to describe the comb-type branched polynucleotides of the invention intends a molecule having at least about 15 branch sites and at least about 20 iterations of the labeled probe binding sequence.
  • Comb-type as used herein to describe the structure of the branched polynucleotides of the invention intends a polynucleotide having a linear backbone with a multiplicity of sidechains extending from the backbone.
  • a "cleavable linker molecule” intends a molecule that may be stably incorporated into a polynucleotide chain and which includes a covalent bond that may be broken or cleaved by chemical treatment or physical treatment such as by irradiation.
  • nucleic acid sequences disclosed herein are written in a 5' to 3' direction. Nucleotides are designated according to the nucleotide symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. All nucleotide sequences disclosed are intended to include complementary sequences unless otherwise indicated.
  • the general protocol for the solution phase sandwich hybridizations is as follows.
  • the analyte nucleic acid is placed in a microtiter well with an excess of two single-stranded nucleic acid probe sets: (1) a set of capture probes, each having a first binding sequence substantially complementary to the analyte and a second binding sequence that is substantially complementary to nucleic acid bound to a solid support, for example, the well surface or a bead, and (2) a set of amplifier probes (branched or linear), each having a first binding sequence that is capable of specific binding to the analyte and a second binding sequence that is capable of specific binding to a segment of the multimer.
  • the resulting product is a three component nucleic acid complex of the two probes hybridized to the analyte by their first binding sequences.
  • the second binding sequences of the probes remain as single-stranded segments as they are not substantially complementary to the analyte.
  • This complex hybridizes to the immobilized probe on the solid surface via the second binding sequence of the capture probe.
  • the resulting product comprises the complex bound to the solid surface via the duplex formed by the oligonucleotide bound to the solid surface and the second binding sequence of the capture probe. Unbound materials are then removed from the surface such as by washing.
  • the amplification multimer is then added to the bound complex under hybridization conditions to permit the multimer to hybridize to the available second binding sequence(s) of the amplifier probe of the complex.
  • the resulting complex is then separated from any unbound multimer by washing.
  • the labeled oligonucleotide is then added under conditions which permit it to hybridize to the complementary oligonucleotide units of the multimer.
  • the resulting immobilized labeled nucleic acid complex is then washed to remove unbound labeled oligonucleotide, and read.
  • the analyte nucleic acids may be from a variety of sources, e.g., biological fluids or solids, and may be prepared for the hybridization analysis by a variety of means, e.g., proteinase K/SDS, chaotropic salts, etc. Also, it may be of advantage to decrease the average size of the analyte nucleic acids by enzymatic, physical or chemical means, e.g., restriction enzymes, sonication, chemical degradation (e.g., metal ions), etc.
  • the fragments may be as small as 0.1 kb, usually being at least about 0.5 kb and may be 1 kb or higher.
  • the analyte sequence is provided in single-stranded form for analysis.
  • sequence is naturally present in single-stranded form, denaturation will not be required. However, where the sequence may be present in double-stranded form, the sequence should be denatured. Denaturation can be carried out by various techniques, such as alkali, generally from about 0.05 to 0.2M hydroxide, formamide, salts, heat, enzymes, or combinations thereof.
  • the first binding sequences of the capture probe and amplifier probe that are substantially complementary to the analyte sequence will each be of at least 15 nucleotides, usually at least 25 nucleotides, and not more than about 5 kb, usually not more than about 1 kb, preferably not more than about 100 nucleotides. They will typically be approximately 30 nucleotides. They will normally be chosen to bind to different sequences of the analyte.
  • the first binding sequences may be selected based on a variety of considerations. Depending upon the nature of the analyte, one may be interested in a consensus sequence, a sequence associated with polymorphisms, a particular phenotype or genotype, a particular strain, or the like.
  • the number of different amplifier and capture probes used influences the sensitivity of the assay, because the more probe sequences used, the greater the signal provided by the assay system. Furthermore, the use of more probe sequences allows the use of more stringent hybridization conditions, thereby reducing the incidence of false positive results.
  • the number of probes in a set will be at least one capture probe and at least one amplifier probe, more preferably two capture and two amplifier probes, and most preferably 5-100 capture probes and 5-100 amplifier probes.
  • Oligonucleotide probes for HAV were designed by aligning the RNA sequences of five HAV isolates available from GenBank. Regions of greatest homology were chosen for capture probes, while regions of lesser homology were chosen as amplifier probes. Thus, as additional strains or isolates of HAV are made available, appropriate probes made be designed by aligning the sequence of the new strain or isolate with the nucleotide sequences used to design the probes of the present invention, and choosing regions of greatest homology for use as capture probes, with regions of lesser homology chosen as amplifier probes.
  • the probe sequences of the presently preferred probe sets are contiguous and roughly correspond to nucleotides 1-1300 of the HAV genome. The nucleotide sequences of the presently preferred probe sets are shown in the examples.
  • the second binding sequences of the capture probe and amplifier probe are selected to be substantially complementary, respectively, to the oligonucleotide bound to the solid surface and to a segment of the multimer and so as to not be encountered by endogenous sequences in the sample/analyte.
  • the second binding sequence may be contiguous to the first binding sequence or be spaced therefrom by an intermediate noncomplementary sequence.
  • the probes may include other noncomplementary sequences if desired. These noncomplementary sequences must not hinder the binding of the binding sequences or cause nonspecific binding to occur.
  • the capture probe and amplifier probe may be prepared by oligonucleotide synthesis procedures or by cloning, preferably the former.
  • binding sequences need not have perfect complementarity to provide homoduplexes.
  • heteroduplexes will suffice where fewer than about 10% of the bases are mismatches, ignoring loops of five or more nucleotides.
  • complementary intends exact complementarity wherein each base within the binding region corresponds exactly, and “substantially complementary” intends 90% or greater homology.
  • the labeled oligonucleotide will include a sequence substantially complementary to the repeated oligonucleotide units of the multimer.
  • the labeled oligonucleotide will include one or more molecules ("labels"), which directly or indirectly provide a detectable signal.
  • the labels may be bound to individual members of the substantially complementary sequence or may be present as a terminal member or terminal tail having a plurality of labels.
  • Various means for providing labels bound to the oligonucleotide sequences have been reported in the literature. See, for example, Leary et al., Proc. Natl. Acad. Sci. USA (1983) 80:4045; Renz and Kurz, Nucl. Acids Res.
  • the labels may be bound either covalently or non-covalently to the substantially complementary sequence.
  • Labels which may be employed include radionuclides, fluorescers, chemiluminescers, dyes, enzymes, enzyme substrates, enzyme cofactors, enzyme inhibitors, enzyme subunits, metal ions, and the like.
  • Illustrative specific labels include fluorescein, rhodamine, Texas red, phycoerythrin, umbelliferone, luminol, NADPH, ⁇ - ⁇ -galactosidase, horseradish peroxidase, alkaline phosphatase, etc.
  • the ratio of capture probe and amplifier probe to anticipated moles of analyte will each be at least stoichiometric and preferably in excess. This ratio is preferably at least about 1.5:1, and more preferably at least 2:1. It will normally be in the range of 2:1 to 10 6 :1. Concentrations of each of the probes will generally range from about 10 -5 to 10 -9 M, with sample nucleic acid concentrations varying from 10 -21 to 10 -12 M.
  • the hybridization steps of the assay will generally take from about 10 minutes to 20 hours, frequently being completed in about 1 hour. Hybridization can be carried out at a mildly elevated temperature, generally in the range from about 20° C. to 80° C., more usually from about 35° C. to 70° C., particularly 65° C.
  • the hybridization reactions are usually done in an aqueous medium, particularly a buffered aqueous medium, which may include various additives.
  • Additives which may be employed include low concentrations of detergent (0.01 to 1%), salts, e.g., sodium citrate (0.017 to 0.17M), Ficoll, polyvinylpyrrolidone, carrier nucleic acids, carrier proteins, etc.
  • Nonaqueous solvents may be added to the aqueous medium, such as dimethylformamide, dimethylsulfoxide, alcohols, and formamide. These other solvents are generally present in amounts ranging from 2 to 50%.
  • the stringency of the hybridization medium may be controlled by temperature, salt concentration, solvent system, and the like. Thus, depending upon the length and nature of the sequence of interest, the stringency will be varied.
  • various techniques can be employed for detecting the presence of the label.
  • fluorescers a large number of different fluorometers are available.
  • chemiluminescers luminometers or films are available.
  • enzymes a fluorescent, chemiluminescent, or colored product can be provided and determined fluorometrically, luminometrically, spectrophotometrically or visually.
  • the various labels which have been employed in immunoassays and the techniques applicable to immunoassays can be employed with the subject assays.
  • Kits for carrying out amplified nucleic acid hybridization assays will comprise in packaged combination the following reagents: the amplifier probe or set of probes; the capture probe or set of probes; the amplifier multimer; and an appropriate labeled oligonucleotide. These reagents will typically be in separate containers in the kit.
  • the kit may also include a denaturation reagent for denaturing the analyte, hybridization buffers, wash solutions, enzyme substrates, negative and positive controls and written instructions for carrying out the assay.
  • This example illustrates the synthesis of a comb-type branched polynucleotide having 15 branch sites and sidechain extensions having three labeled probe binding sites.
  • This polynucleotide was designed to be used in a solution phase hybridization as described in EPA 883096976.
  • a comb body of the following structure was first prepared: ##STR1## wherein X' is a branching monomer, and R is a periodate cleavable linker.
  • the portion of the comb body through the 15 (TTX') repeats is first synthesized using 33.8 mg aminopropyl-derivatized thymidine controlled pore glass (CPG) (2000 ⁇ , 7.4 micromoles thymidine per gram support) with a 1.2 cycle protocol.
  • CPG thymidine controlled pore glass
  • the branching site nucleotide was of the formula: ##STR2## where R 2 represents ##STR3##
  • the concentration of beta cyanoethylphosphoramidite monomers was 0.1M for A, C, G and T, 0.15M for the branching site monomer E, and 0.2M for PHOSTELTM reagent (DMT--O--CH 2 CH 2 --(SO 2 )--CH 2 CH 2 --O--P(--N(iPr) 2 )(--O--CH 2 CH 2 CN) wherein DMT is dimethoxytrityl and iPr is isopropyl).
  • Detritylation was done with 3% trichloroacetic acid in methylene chloride using stepped flowthrough for the duration of the deprotection. At the conclusion the 5' DMT was replaced with an acetyl group.
  • Cleavable linker R and six base sidechain extensions of the formula 3'-RGTCAGTp were synthesized at each branching monomer site as follows.
  • the base protecting group removal (R 2 in the formula above) was performed manually while retaining the CPG support in the same column used for synthesizing the comb body.
  • R 2 levulinyl
  • a solution of 0.5M hydrazine hydrate in pyridine/glacial acetic acid (1:1 v/v) was introduced and kept in contact with the CPG support for 90 min with renewal of the liquid every 15 min, followed by extensive washing with pyridine/glacial acetic acid (1:1 v/v) and then by acetonitrile.
  • the cleavable linker R and six base sidechain extensions were added using a 6.4 cycle.
  • the concentration of phosphoramidites was 0.1M (except 0.2M R and PHOSTELTM reagent (DMT--O--CH 2 CH 2 --(SO 2 )--CH 2 CH 2 --O--P(--N(iPr) 2 )(--O--CH 2 CH 2 CN) wherein DMT is dimethoxytrityl and iPr is isopropyl); R was 2-(4-(4-(2-Dimethoxytrityloxy)ethyl-)phenoxy 2,3-di(benzoyloxy)butyloxy)phenyl)ethyl-2-cyanoethyl-N,N-diisopropylphosphoramidite).
  • Detritylation is effected with a solution of 3% trichloroacetic acid in methylene chloride using continuous flowthrough, followed by a rinse solution of toluene/chloromethane (1:1 v/v). Branched polynucleotide chains were removed from the solid supports automatically in the 380B using the cycle "CE NH 3 .”
  • the ammonium hydroxide solution was collected in 4 ml screw-capped Wheaton vials and heated at 60° C. for 12 hr to remove all base-protecting groups. After cooling to room temperature the solvent was removed in a Speed-Vac evaporator and the residue dissolved in 100 ⁇ l water.
  • the crude comb body was purified by a standard polyacrylamide gel (7% with 7M urea and 1X TBE running buffer) method.
  • the 3' backbone extension and the sidechain extensions were ligated to the comb body as follows.
  • the comb body (4 pmole/ ⁇ l), 3' backbone extension (6.25 pmole/ ⁇ l) , sidechain extension (93.75 pmole/ ⁇ l), sidechain linking template (75 pmoles/ ⁇ l) and backbone linking template (5 pmole/ ⁇ l) were combined in 1 mM ATP/5 mM DTT/50 mM Tris-HCl, pH 8.0/10 mM MgCl 2 /2 mM spermidine, with 0.5 units/ ⁇ l T4 polynucleotide kinase. The mixture was incubated at 37° C.
  • the mixture was adjusted to 1 mM ATP, 5 mM DTT, 14% polyethylene glycol, 50 mM Tris-HCl, pH 7.5, 10 mM MgCl 2 , 2 mM spermidine, 0.5 units/ ⁇ l T4 polynucleotide kinase, and 0.21 units/ ⁇ l T4 ligase were added, and the mixture incubated at 23° C. for 16-24 hr. Ligation products were then purified by polyacrylamide gel electrophoresis.
  • a “15 ⁇ 3" amplified solution phase nucleic acid sandwich hybridization assay format was used in this assay.
  • the "15 ⁇ 3" designation derives from the fact that the format employs two multimers: (1) an amplifier probe having a first segment (A) that binds to HAV and a second segment (B) that hybridizes to (2) an amplifier multimer having a first segment (B*) that hybridizes to the segment (B) and fifteen iterations of a segment (C), wherein segment C hybridizes to three labeled oligonucleotides.
  • the amplifier and capture probe segments and their respective names used in this assay were as follows.
  • Each amplifier probe contained, in addition to the sequences substantially complementary to the HAV sequences, the following 5' extension complementary to a segment of the amplifier multimer,
  • Each capture probe contained, in addition to the sequences substantially complementary to HAV RNA, a downstream sequence complementary to DNA bound to the solid phase (XT1*),
  • Microtiter plates were prepared as follows. White Microlite 1 Removawell strips (polystyrene microtiter plates, 96 wells/plate) were purchased from Dynatech Inc. Each well was filled with 200 ⁇ l 1N HCl and incubated at room temperature for 15-20 min. The plates were then washed 4 times with 1X PBS and the wells aspirated to remove liquid. The wells were then filled with 200 ⁇ l 1N NaOH and incubated at room temperature for 15-20 min. The plates were again washed 4 times with 1X PBS and the wells aspirated to remove liquid.
  • Poly(phe-lys) was purchased from Sigma Chemicals, Inc. This polypeptide has a 1:1 molar ratio of phe:lys and an average m.w. of 47,900 gm/mole. It has an average length of 309 amino acids and contains 155 amines/mole.
  • a 1 mg/ml solution of the polypeptide was mixed with 2M NaCl/1X PBS to a final concentration of 0.1 mg/ml (pH 6.0). 100 ⁇ L of this solution was added to each well. The plate was wrapped in plastic to prevent drying and incubated at 30° C. overnight. The plate was then washed 4 times with 1X PBS and the wells aspirated to remove liquid.
  • XT1* The following procedure was used to couple the oligonucleotide XT1* to the plates. Synthesis of XT1* was described in EPA 883096976. 20 mg disuccinimidyl suberate was dissolved in 300 ⁇ l dimethyl formamide (DMF). 26 OD 260 units of XT1* was added to 100 ⁇ l coupling buffer (50 mM sodium phosphate, pH 7.8). The coupling mixture was then added to the DSS-DMF solution and stirred with a magnetic stirrer for 30 min. An NAP-25 column was equilibrated with 10 mM sodium phosphate, pH 6.5.
  • DMF dimethyl formamide
  • DSS-DMF solution was added to 2 ml 10 mM sodium phosphate, pH 6.5, at 4° C. The mixture was vortexed to mix and loaded onto the equilibrated NAP-25 column.
  • DSS-activated XT1* DNA was eluted from the column with 3.5 ml 10 mM sodium phosphate, pH 6.5. 5.6 OD 260 units of eluted DSS-activated XT1* DNA was added to 1500 ml 50 mM sodium phosphate, pH 7.8. 50 ⁇ l of this solution was added to each well and the plates were incubated overnight. The plate was then washed 4 times with 1X PBS and the wells aspirated to remove liquid.
  • the HAV-infected cell culture (100% HAV infected FRhK4 cell line) and the uninfected cell culture (FRhK4 cell line) were prepared as follows.
  • Cells were trypsinized in STV (equal parts 0.25% trypsin and 1:2000 versene (Sigma Chemical Co.) in PBS) and resuspended in 5 ml of the medium (DMEM with 20% FBS) the cells were grown in. The cells were then counted in a hemocytometer and diluted to 10 5 cells/10 ⁇ l, 10 4 cells/10 ⁇ l 10 3 cells/10 ⁇ l, and 10 2 cells/10 ⁇ l.
  • a cocktail of the HAV-specific amplifier and capture probes was prepared in a proteinase K solution prepared by first adding 10 mg proteinase K to 5 ml capture diluent (53 mM Tris-HCl, pH 8.0/10.6 mM EDTA/1.3% SDS/16 ⁇ g/ml sonicated salmon sperm DNA/5.3X SSC/1 mg/ml proteinase K/7% formamide).
  • the cocktail contained 50 fmoles of each probe in 30 ⁇ l buffer. 30 ⁇ l of this solution was added to each well. 10 ⁇ l of the appropriate dilution of the uninfected and infected cells as described above was then added to each well. Plates were covered and agitated to mix samples, then incubated at 65° C. overnight.
  • Alkaline phosphatase label probe disclosed in EP 883096976 was then added to each well (20 fmoles/well in 40 ⁇ l 4X SSC/0.1% SDS/0.5% Blocking Reagent). After incubation at 55° C. for 15 min, and 5-10 min at room temperature, the wells were washed twice as above and then 3x with 0.015M NACl/0.0015M sodium citrate.
  • Results are shown in the Table below. Results for each standard sample are expressed as the difference between the mean of the negative control plus two standard deviations and the mean of the sample minus two standard deviations (delta). If delta is greater than zero, the sample is considered positive. These results indicate a sensitivity of about 10 3-10 4 HAV molecules.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • Virology (AREA)
  • Communicable Diseases (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Novel DNA probe sequences for detection of HAV in a sample in a solution phase sandwich hybridization assay are described. Amplified nucleic acid hybridization assays using the probes are exemplified.

Description

This application is a continuation of U.S. Ser. No. 07/813,589 filed 23 Dec. 1991, now abandoned.
DESCRIPTION
1. Technical Field
This invention is in the field of nucleic acid hybridization assays. More specifically, it relates to novel nucleic acid probes for detecting Hepatitis A Virus (HAV).
2. Background Art
Hepatitis A virus is an RNA virus belonging to the picornavirus family and is thought to be responsible for at least 38% of all reported cases of hepatitis. Cohen et al. (J. Virol. 61:50-59, 1987) described the complete nucleotide sequence of wild-type Hepatitis A virus and compared the sequence with laboratory-adapted HAV strains and with other picornaviruses, finding most amino acid differences occurred in the capsid region, whereas most nucleotide differences occurred randomly throughout the genome.
Commonly owned U.S. Pat. No. 4,868,105 issued 19 Sep. 1989, describes a solution phase nucleic acid sandwich hybridization assay in which analyte nucleic acid is first hybridized in solution to a labeling probe set and to a capturing probe set in a first vessel. The probe-analyte complex is then transferred to a second vessel that contains a solid-phase-immobilized probe that is complementary to a segment of the capturing probes. The segments hybridize to the immobilized probe, thus removing the complex from solution. Having the analyte in the form of an immobilized complex facilitates subsequent separation steps in the assay. Ultimately, single stranded segments of the labeling probe set are hybridized to labeled probes, thus permitting the analyte-containing complex to be detected via a signal generated directly or indirectly from the label.
Commonly owned European Patent Application (EPA) 883096976 discloses a variation in the assay described in U.S. Pat. No. 4,868,105, issued 19 Sep. 1989, in which the signal generated by the labeled probes is amplified. The amplification involves the use of nucleic acid multimers. These multimers are branched polynucleotides that are constructed to have a segment that hybridizes specifically to the analyte nucleic acid or to a nucleic acid (branched or linear) that is bound to the analyte and iterations of a second segment that hybridize specifically to the labeled probe. In the assay employing the multimer, the initial steps of hybridizing the analyte to label or amplifier probe sets and capturing probe sets in a first vessel and transferring the complex to another vessel containing immobilized nucleic acid that will hybridize to a segment of the capturing probes are followed. The multimer is then hybridized to the immobilized complex and the labeled probes in turn hybridized to the second segment iterations on the multimer. Since the multimers provide a large number of sites for label probe attachment, the signal is amplified. Amplifier and capture probe sequences are disclosed for Hepatitis B virus, Neisseria gonorrhoeae, penicillin and tetracycline resistance in N. gonorrhoeae, and Chlamydia trachomatis.
Commonly owned copending application Ser. No. 558,897, filed 27 Jul. 1990, published as WO92/02526 on 20 Feb. 1992, describes the preparation of large comb-type branched polynucleotide multimers for use in the above-described solution phase assay. The combs provide greater signal enhancement in the assays than the smaller multimers.
DISCLOSURE OF THE INVENTION
One aspect of the invention is a synthetic oligonucleotide useful as an amplifier probe in a sandwich hybridization assay for HAV comprising a first segment having a nucleotide sequence substantially complementary to a segment of HAV nucleic acid, and a second segment having a nucleotide sequence substantially complementary to an oligonucleotide acid multimer.
Another aspect of the invention is a synthetic oligonucleotide useful as a capture probe in a sandwich hybridization assay for HAV comprising a first segment having a nucleotide sequence substantially complementary to a segment of HAV nucleic acid; and a second segment having a nucleotide sequence substantially complementary to an oligonucleotide bound to a solid phase.
Another aspect of the invention is a solution sandwich hybridization assay for detecting the presence of HAV in a sample, comprising
(a) contacting the sample under hybridizing conditions with an excess of (i) an amplifier probe oligonucleotide comprising a first segment having a nucleotide sequence substantially complementary to a segment of HAV nucleic acid and a second segment having a nucleotide sequence substantially complementary to an oligonucleotide unit of a nucleic acid multimer and (ii) a capture probe oligonucleotide comprising a first segment having a nucleotide sequence that is substantially complementary to a segment of HAV nucleic acid and a second segment that is substantially complementary to an oligonucleotide bound to a solid phase;
(b) contacting the product of step (a) under hybridizing conditions with said oligonucleotide bound to the solid phase;
(c) thereafter separating materials not bound to the solid phase;
(d) contacting the product of step (c) under hybridization conditions with the nucleic acid multimer, said multimer comprising at least one oligonucleotide unit that is substantially complementary to the second segment of the amplifier probe polynucleotide and a multiplicity of second oligonucleotide units that are substantially complementary to a labeled oligonucleotide;
(e) removing unbound multimer;
(f) contacting under hybridizing conditions the solid phase complex product of step (e) with the labeled oligonucleotide;
(g) removing unbound labeled oligonucleotide; and
(h) detecting the presence of label in the solid phase complex product of step (g).
Another aspect of the invention is a kit for the detection of HAV comprising a kit for the detection of HAv in a sample comprising in combination
(i) a set of amplifier probe oligonucleotides wherein the amplifier probe oligonucleotide comprises a first segment having a nucleotide sequence substantially complementary to a segment of HAV nucleic acid and a second segment having a nucleotide sequence substantially complementary to an oligonucleotide unit of a nucleic acid multimer;
(ii) a set of capture probe oligonucleotides wherein the capture probe oligonucleotide comprises a first segment having a nucleotide sequence that is substantially complementary to a segment of HAV nucleic acid and a second segment that is substantially complementary to an oligonucleotide bound to a solid phase;
(iii) a nucleic acid multimer, said multimer comprising at least one oligonucleotide unit that is substantially complementary to the second segment of the amplifier probe polynucleotide and a multiplicity of second oligonucleotide units that are substantially complementary to a labeled oligonucleotide; and
(iv) a labeled oligonucleotide.
MODES FOR CARRYING OUT THE INVENTION Definitions
"Solution phase nucleic acid hybridization assay" intends the assay techniques described and claimed in commonly owned U.S. Pat. No. 4,868,105 and EPA 883096976.
A "modified nucleotide" intends a nucleotide monomer that may be stably incorporated into a polynucleotide and which has an additional functional group. Preferably, the modified nucleotide is a 5'-cytidine in which the N4 -position is modified to provide a functional hydroxy group.
An "amplifier multimer" intends a branched polynucleotide that is capable of hybridizing simultaneously directly or indirectly to analyte nucleic acid and to a multiplicity of polynucleotide iterations (i.e., either iterations of another multimer or iterations of a labeled probe). The branching in the multimers is effected through covalent bonds and the multimers are composed of two types of oligonucleotide units that are capable of hybridizing, respectively, to analyte nucleic acid or nucleic acid hybridized to analyte nucleic acid and to a multiplicity of labeled probes. The composition and preparation of such multimers are described in EPA 883096976 and U.S. Ser. No. 558,897 filed 27 Jul. 1990, published as WO92/02526 on 20 Feb. 1992, the disclosures of which are incorporated herein by reference.
The term "amplifier probe" is intended as a branched or linear polynucleotide that is constructed to have a segment that hybridizes specifically to the analyte nucleic acid and iterations of a second segment that hybridize specifically to an amplifier multimer.
The term "capture probe" is intended as an oligonucleotide having a segment substantially complementary to a nucleotide sequence of the target DNA and a segment that is substantially complementary to a nucleotide sequence of a solid-phase-immobilized probe.
"Large" as used herein to describe the comb-type branched polynucleotides of the invention intends a molecule having at least about 15 branch sites and at least about 20 iterations of the labeled probe binding sequence.
"Comb-type" as used herein to describe the structure of the branched polynucleotides of the invention intends a polynucleotide having a linear backbone with a multiplicity of sidechains extending from the backbone.
A "cleavable linker molecule" intends a molecule that may be stably incorporated into a polynucleotide chain and which includes a covalent bond that may be broken or cleaved by chemical treatment or physical treatment such as by irradiation.
All nucleic acid sequences disclosed herein are written in a 5' to 3' direction. Nucleotides are designated according to the nucleotide symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. All nucleotide sequences disclosed are intended to include complementary sequences unless otherwise indicated.
Solution Phase Hybridization Assay
The general protocol for the solution phase sandwich hybridizations is as follows. The analyte nucleic acid is placed in a microtiter well with an excess of two single-stranded nucleic acid probe sets: (1) a set of capture probes, each having a first binding sequence substantially complementary to the analyte and a second binding sequence that is substantially complementary to nucleic acid bound to a solid support, for example, the well surface or a bead, and (2) a set of amplifier probes (branched or linear), each having a first binding sequence that is capable of specific binding to the analyte and a second binding sequence that is capable of specific binding to a segment of the multimer. The resulting product is a three component nucleic acid complex of the two probes hybridized to the analyte by their first binding sequences. The second binding sequences of the probes remain as single-stranded segments as they are not substantially complementary to the analyte. This complex hybridizes to the immobilized probe on the solid surface via the second binding sequence of the capture probe. The resulting product comprises the complex bound to the solid surface via the duplex formed by the oligonucleotide bound to the solid surface and the second binding sequence of the capture probe. Unbound materials are then removed from the surface such as by washing.
The amplification multimer is then added to the bound complex under hybridization conditions to permit the multimer to hybridize to the available second binding sequence(s) of the amplifier probe of the complex. The resulting complex is then separated from any unbound multimer by washing. The labeled oligonucleotide is then added under conditions which permit it to hybridize to the complementary oligonucleotide units of the multimer. The resulting immobilized labeled nucleic acid complex is then washed to remove unbound labeled oligonucleotide, and read.
The analyte nucleic acids may be from a variety of sources, e.g., biological fluids or solids, and may be prepared for the hybridization analysis by a variety of means, e.g., proteinase K/SDS, chaotropic salts, etc. Also, it may be of advantage to decrease the average size of the analyte nucleic acids by enzymatic, physical or chemical means, e.g., restriction enzymes, sonication, chemical degradation (e.g., metal ions), etc. The fragments may be as small as 0.1 kb, usually being at least about 0.5 kb and may be 1 kb or higher. The analyte sequence is provided in single-stranded form for analysis. Where the sequence is naturally present in single-stranded form, denaturation will not be required. However, where the sequence may be present in double-stranded form, the sequence should be denatured. Denaturation can be carried out by various techniques, such as alkali, generally from about 0.05 to 0.2M hydroxide, formamide, salts, heat, enzymes, or combinations thereof.
The first binding sequences of the capture probe and amplifier probe that are substantially complementary to the analyte sequence will each be of at least 15 nucleotides, usually at least 25 nucleotides, and not more than about 5 kb, usually not more than about 1 kb, preferably not more than about 100 nucleotides. They will typically be approximately 30 nucleotides. They will normally be chosen to bind to different sequences of the analyte. The first binding sequences may be selected based on a variety of considerations. Depending upon the nature of the analyte, one may be interested in a consensus sequence, a sequence associated with polymorphisms, a particular phenotype or genotype, a particular strain, or the like.
The number of different amplifier and capture probes used influences the sensitivity of the assay, because the more probe sequences used, the greater the signal provided by the assay system. Furthermore, the use of more probe sequences allows the use of more stringent hybridization conditions, thereby reducing the incidence of false positive results. Thus, the number of probes in a set will be at least one capture probe and at least one amplifier probe, more preferably two capture and two amplifier probes, and most preferably 5-100 capture probes and 5-100 amplifier probes.
Oligonucleotide probes for HAV were designed by aligning the RNA sequences of five HAV isolates available from GenBank. Regions of greatest homology were chosen for capture probes, while regions of lesser homology were chosen as amplifier probes. Thus, as additional strains or isolates of HAV are made available, appropriate probes made be designed by aligning the sequence of the new strain or isolate with the nucleotide sequences used to design the probes of the present invention, and choosing regions of greatest homology for use as capture probes, with regions of lesser homology chosen as amplifier probes. The probe sequences of the presently preferred probe sets are contiguous and roughly correspond to nucleotides 1-1300 of the HAV genome. The nucleotide sequences of the presently preferred probe sets are shown in the examples.
The second binding sequences of the capture probe and amplifier probe are selected to be substantially complementary, respectively, to the oligonucleotide bound to the solid surface and to a segment of the multimer and so as to not be encountered by endogenous sequences in the sample/analyte. The second binding sequence may be contiguous to the first binding sequence or be spaced therefrom by an intermediate noncomplementary sequence. The probes may include other noncomplementary sequences if desired. These noncomplementary sequences must not hinder the binding of the binding sequences or cause nonspecific binding to occur.
The capture probe and amplifier probe may be prepared by oligonucleotide synthesis procedures or by cloning, preferably the former.
It will be appreciated that the binding sequences need not have perfect complementarity to provide homoduplexes. In many situations, heteroduplexes will suffice where fewer than about 10% of the bases are mismatches, ignoring loops of five or more nucleotides. Accordingly, as used herein the term "complementary" intends exact complementarity wherein each base within the binding region corresponds exactly, and "substantially complementary" intends 90% or greater homology.
The labeled oligonucleotide will include a sequence substantially complementary to the repeated oligonucleotide units of the multimer. The labeled oligonucleotide will include one or more molecules ("labels"), which directly or indirectly provide a detectable signal. The labels may be bound to individual members of the substantially complementary sequence or may be present as a terminal member or terminal tail having a plurality of labels. Various means for providing labels bound to the oligonucleotide sequences have been reported in the literature. See, for example, Leary et al., Proc. Natl. Acad. Sci. USA (1983) 80:4045; Renz and Kurz, Nucl. Acids Res. (1984) 12:3435; Richardson and Gumport, Nucl. Acids Res. (1983) 11:6167; Smith et al., Nucl. Acids. Res. (1985) 13:2399; Meinkoth and Wahl, Anal. Biochem. (1984) 138:267. The labels may be bound either covalently or non-covalently to the substantially complementary sequence. Labels which may be employed include radionuclides, fluorescers, chemiluminescers, dyes, enzymes, enzyme substrates, enzyme cofactors, enzyme inhibitors, enzyme subunits, metal ions, and the like. Illustrative specific labels include fluorescein, rhodamine, Texas red, phycoerythrin, umbelliferone, luminol, NADPH, α-β-galactosidase, horseradish peroxidase, alkaline phosphatase, etc.
The ratio of capture probe and amplifier probe to anticipated moles of analyte will each be at least stoichiometric and preferably in excess. This ratio is preferably at least about 1.5:1, and more preferably at least 2:1. It will normally be in the range of 2:1 to 106 :1. Concentrations of each of the probes will generally range from about 10-5 to 10-9 M, with sample nucleic acid concentrations varying from 10-21 to 10-12 M. The hybridization steps of the assay will generally take from about 10 minutes to 20 hours, frequently being completed in about 1 hour. Hybridization can be carried out at a mildly elevated temperature, generally in the range from about 20° C. to 80° C., more usually from about 35° C. to 70° C., particularly 65° C.
The hybridization reactions are usually done in an aqueous medium, particularly a buffered aqueous medium, which may include various additives. Additives which may be employed include low concentrations of detergent (0.01 to 1%), salts, e.g., sodium citrate (0.017 to 0.17M), Ficoll, polyvinylpyrrolidone, carrier nucleic acids, carrier proteins, etc. Nonaqueous solvents may be added to the aqueous medium, such as dimethylformamide, dimethylsulfoxide, alcohols, and formamide. These other solvents are generally present in amounts ranging from 2 to 50%.
The stringency of the hybridization medium may be controlled by temperature, salt concentration, solvent system, and the like. Thus, depending upon the length and nature of the sequence of interest, the stringency will be varied.
Depending upon the nature of the label, various techniques can be employed for detecting the presence of the label. For fluorescers, a large number of different fluorometers are available. For chemiluminescers, luminometers or films are available. With enzymes, a fluorescent, chemiluminescent, or colored product can be provided and determined fluorometrically, luminometrically, spectrophotometrically or visually. The various labels which have been employed in immunoassays and the techniques applicable to immunoassays can be employed with the subject assays.
Kits for carrying out amplified nucleic acid hybridization assays according to the invention will comprise in packaged combination the following reagents: the amplifier probe or set of probes; the capture probe or set of probes; the amplifier multimer; and an appropriate labeled oligonucleotide. These reagents will typically be in separate containers in the kit. The kit may also include a denaturation reagent for denaturing the analyte, hybridization buffers, wash solutions, enzyme substrates, negative and positive controls and written instructions for carrying out the assay.
The following examples further illustrate the invention. These examples are not intended to limit the invention in any manner.
EXAMPLES Example I Synthesis of Comb-type Branched Polynucleotide
This example illustrates the synthesis of a comb-type branched polynucleotide having 15 branch sites and sidechain extensions having three labeled probe binding sites. This polynucleotide was designed to be used in a solution phase hybridization as described in EPA 883096976.
All chemical syntheses of oligonucleotides were performed on an automatic DNA synthesizer (Applied Biosystems, Inc., (ABI) model 380 B). Phosphoramidite chemistry of the beta cyanoethyl type was used including 5'-phosphorylation which employed PHOSTEL™ reagent (DMT--O--CH2 CH2 --(SO2)--CH2 CH2 --O--P(--N(iPr)2)(--O--CH2 CH2 CN) wherein DMT is dimethoxytrityl and iPr is isopropyl) (ABN). Standard ABI protocols were used except as indicated. Where it is indicated that a multiple of a cycle was used (e.g., 1.2 cycle), the multiple of the standard amount of amidite recommended by ABI was employed in the specified cycle. Appended hereto are the programs for carrying out cycles 1.2 and 6.4 as run on the Applied Biosystems Model 380 B DNA Synthesizer.
A comb body of the following structure was first prepared: ##STR1## wherein X' is a branching monomer, and R is a periodate cleavable linker.
The portion of the comb body through the 15 (TTX') repeats is first synthesized using 33.8 mg aminopropyl-derivatized thymidine controlled pore glass (CPG) (2000 Å, 7.4 micromoles thymidine per gram support) with a 1.2 cycle protocol. The branching site nucleotide was of the formula: ##STR2## where R2 represents ##STR3##
For synthesis of the comb body (not including sidechains), the concentration of beta cyanoethylphosphoramidite monomers was 0.1M for A, C, G and T, 0.15M for the branching site monomer E, and 0.2M for PHOSTEL™ reagent (DMT--O--CH2 CH2 --(SO2)--CH2 CH2 --O--P(--N(iPr)2)(--O--CH2 CH2 CN) wherein DMT is dimethoxytrityl and iPr is isopropyl). Detritylation was done with 3% trichloroacetic acid in methylene chloride using stepped flowthrough for the duration of the deprotection. At the conclusion the 5' DMT was replaced with an acetyl group.
Cleavable linker R and six base sidechain extensions of the formula 3'-RGTCAGTp (SEQ ID NO:1) were synthesized at each branching monomer site as follows. The base protecting group removal (R2 in the formula above) was performed manually while retaining the CPG support in the same column used for synthesizing the comb body. In the case of R2 =levulinyl, a solution of 0.5M hydrazine hydrate in pyridine/glacial acetic acid (1:1 v/v) was introduced and kept in contact with the CPG support for 90 min with renewal of the liquid every 15 min, followed by extensive washing with pyridine/glacial acetic acid (1:1 v/v) and then by acetonitrile. After the deprotection the cleavable linker R and six base sidechain extensions were added using a 6.4 cycle.
In these syntheses the concentration of phosphoramidites was 0.1M (except 0.2M R and PHOSTEL™ reagent (DMT--O--CH2 CH2 --(SO2)--CH2 CH2 --O--P(--N(iPr)2)(--O--CH2 CH2 CN) wherein DMT is dimethoxytrityl and iPr is isopropyl); R was 2-(4-(4-(2-Dimethoxytrityloxy)ethyl-)phenoxy 2,3-di(benzoyloxy)butyloxy)phenyl)ethyl-2-cyanoethyl-N,N-diisopropylphosphoramidite).
Detritylation is effected with a solution of 3% trichloroacetic acid in methylene chloride using continuous flowthrough, followed by a rinse solution of toluene/chloromethane (1:1 v/v). Branched polynucleotide chains were removed from the solid supports automatically in the 380B using the cycle "CE NH3." The ammonium hydroxide solution was collected in 4 ml screw-capped Wheaton vials and heated at 60° C. for 12 hr to remove all base-protecting groups. After cooling to room temperature the solvent was removed in a Speed-Vac evaporator and the residue dissolved in 100 μl water.
3' backbone extensions (segment A), sidechain extensions and ligation template/linkers of the following structures were also made using the automatic synthesizer:
__________________________________________________________________________
3' Backbone                                                               
          3'-TCCGTATCCTGGGCACAGAGGTGCp-5'                                 
                               (SEQ ID NO:2)                              
extension                                                                 
Sidechain 3'-GATGCG(TTCATGCTGTTGGTGTAG).sub.3 -5'                         
                               (SEQ ID NO:3)                              
extension                                                                 
Ligation template                                                         
          3'-AAAAAAAAAAGCACCTp-5'                                         
                               (SEQ ID NO:4)                              
for linking 3'                                                            
backbone extension                                                        
Ligation template                                                         
          3'-CGCATCACTGAC-5'   (SEQ ID NO:5)                              
for linking                                                               
sidechain extension                                                       
__________________________________________________________________________
The crude comb body was purified by a standard polyacrylamide gel (7% with 7M urea and 1X TBE running buffer) method.
The 3' backbone extension and the sidechain extensions were ligated to the comb body as follows. The comb body (4 pmole/μl), 3' backbone extension (6.25 pmole/μl) , sidechain extension (93.75 pmole/μl), sidechain linking template (75 pmoles/μl) and backbone linking template (5 pmole/μl) were combined in 1 mM ATP/5 mM DTT/50 mM Tris-HCl, pH 8.0/10 mM MgCl2 /2 mM spermidine, with 0.5 units/μl T4 polynucleotide kinase. The mixture was incubated at 37° C. for 2 hr, then heated in a water bath to 95° C., and then slowly cooled to below 35° C. over a 1 hr period. 2 mM ATP, 10 mM DTT, 14% polyethylene glycol, and 0.21 units/μl T4 ligase were added, and the mixture incubated for 16-24 hr at 23° C. The DNA was precipitated in NaCl/ethanol, resuspended in water, and subjected to a second ligation as follows. The mixture was adjusted to 1 mM ATP, 5 mM DTT, 14% polyethylene glycol, 50 mM Tris-HCl, pH 7.5, 10 mM MgCl2, 2 mM spermidine, 0.5 units/μl T4 polynucleotide kinase, and 0.21 units/μl T4 ligase were added, and the mixture incubated at 23° C. for 16-24 hr. Ligation products were then purified by polyacrylamide gel electrophoresis.
After ligation and purification, a portion of the product was labeled with 32 p and subjected to cleavage at the site of R achieved by oxidation with aqueous NaIO4 for 1 hr. The sample was then analyzed by PAGE to determine the number of sidechain extensions incorporated by quantitating the radioactive label in the bands on the gel. The product was found to have a total of 45 labeled probe binding sites.
Example II Procedure for HAV Assay
A "15×3" amplified solution phase nucleic acid sandwich hybridization assay format was used in this assay. The "15×3" designation derives from the fact that the format employs two multimers: (1) an amplifier probe having a first segment (A) that binds to HAV and a second segment (B) that hybridizes to (2) an amplifier multimer having a first segment (B*) that hybridizes to the segment (B) and fifteen iterations of a segment (C), wherein segment C hybridizes to three labeled oligonucleotides.
The amplifier and capture probe segments and their respective names used in this assay were as follows.
______________________________________                                    
HAV Amplifier Probes                                                      
HAV.6 (SEQ ID NO:6)                                                       
ATAGAAGTATTAGCCTAAGAGGTTTCACCCGTA                                         
HAV.7 (SEQ ID NO:7)                                                       
CCGCCGCTGTTRCCCTATCCAARGCATCTCTTC                                         
HAV.8 (SEQ ID NO:8)                                                       
TGAATGGTTTTTGTCTTAACAACTCACCAATAT                                         
HAV.9 (SEQ ID NO:9)                                                       
GCATCCACTGGATGAGAGYCAGTCCTCCGGCGT                                         
HAV.10 (SEQ ID NO:10)                                                     
CTARAGACAGCCCTGACARTCAATCCACTCAAT                                         
HAV.11 (SEQ ID NO:11)                                                     
TTGCCCTAAGCACAGAGAGGTCTGRRATTAARC                                         
HAV.12 (SEQ ID NO:12)                                                     
TCTCACAGRATCCCATTTAAGGCCAAATGRTGT                                         
HAV.13 (SEQ ID NO:13)                                                     
AAGAACAGTCCAGCTGTCAATGGAGGGAYCCCC                                         
HAV.14 (SEQ ID NO:14)                                                     
GTACCTCAGAGGCAAACACCACATAAGGCCCCA                                         
HAV.15 (SEQ ID NO:15)                                                     
TTTAAGAATGAGGAAAAACCTAAATGCCCCTGA                                         
HAV.16 (SEQ ID NO:16)                                                     
GGAAAATWCCTTGTYTRGACATRTTCATTATTR                                         
HAV.17 (SEQ ID NO:17)                                                     
ACAGGATGTGGTCAAGRCCACTCCCRACAGTCT                                         
HAV.18 (SEQ ID NO:18)                                                     
GAATCATTTGCTCTTCCTCAATRTCTGCCAAAG                                         
HAV.19 (SEQ ID NO:19)                                                     
AAGCWCCAGTCACTGCAGTCCTAWCAACKGAYT                                         
HAV.20 (SEQ ID NO:20)                                                     
GAACTGAAGATTGRTCCACAGAAGTRAARTAAG                                         
HAV.21 (SEQ ID NO:21)                                                     
GTTCAAYYTGRTGTRAKCCAACCTCAGCWGTAT                                         
HAV.22 (SEQ ID NO:22)                                                     
TWGAACYRGGTTTATCAACAGAGGTTYTCAARG                                         
HAV.23 (SEQ ID NO:23)                                                     
GAATCARGAAAAAYTTYTCYCCCTGAGTYYTCT                                         
HAV.24 (SEQ ID NO:24)                                                     
ADAGAGCATGTGTAGTRAGCCAATCWGCAGAAT                                         
HAV.25 (SEQ ID NO:25)                                                     
RTTTCACCACRTCCAATTTTGCAACTTCATGRA                                         
HAV.26 (SEQ ID NO:26)                                                     
AMCCTTGRACRGCAAACTGCTCATTRTAYARTA                                         
HAV.27 (SEQ ID NO:27)                                                     
TGCCAAATCTTGCATATGTRTGGTATCTCAACA                                         
HAV Capture Probes                                                        
HAV.1 (SEQ ID NO:28)                                                      
CGCAACGGCCAGAGCCTAGGGCAAGGGGAGAGC                                         
HAV.2 (SEQ ID NO:29)                                                      
CTCCATGCTAATCATGGAGTTGACCCCGCCGGG                                         
HAV.3 (SEQ ID NO:30)                                                      
AMACATCTGYGTCCCCAATTTAGACTCCTACAG                                         
HAV.4 (SEQ ID NO:31)                                                      
GARAGCCAAGTTWACACTGCAAGGTGACGTYCC                                         
HAV.5 (SEQ ID NO:32)                                                      
GCCTACCCCTTGTGGAAGATCAAAGAGRTTCAT                                         
HAV.28 (SEQ ID NO:33)                                                     
ARGGTGTRGGRTTTATCTGAACTTGAATYTCAA                                         
HAV.29 (SEQ ID NO:34)                                                     
GAACCATRGCACARATYARYCCYCCYTGYTGRA                                         
HAV.30 (SEQ ID NO:35)                                                     
AKGATGCTATHGAACCATARCTYTGGTCACYAG                                         
HAV.31 (SEQ ID NO:36)                                                     
TGCAATTTAACARACCATGAGGATAAACAGTCA                                         
HAV.32 (SEQ ID NO:37)                                                     
ATGGAACCTTTATTCTAACYACATTGTTRATRT                                         
______________________________________                                    
Each amplifier probe contained, in addition to the sequences substantially complementary to the HAV sequences, the following 5' extension complementary to a segment of the amplifier multimer,
AGGCATAGGACCCGTGTCTT (SEQ ID NO:38).
Each capture probe contained, in addition to the sequences substantially complementary to HAV RNA, a downstream sequence complementary to DNA bound to the solid phase (XT1*),
CTTCTTTGGAGAAAGTGGTG (SEQ ID NO:39).
Microtiter plates were prepared as follows. White Microlite 1 Removawell strips (polystyrene microtiter plates, 96 wells/plate) were purchased from Dynatech Inc. Each well was filled with 200 μl 1N HCl and incubated at room temperature for 15-20 min. The plates were then washed 4 times with 1X PBS and the wells aspirated to remove liquid. The wells were then filled with 200 μl 1N NaOH and incubated at room temperature for 15-20 min. The plates were again washed 4 times with 1X PBS and the wells aspirated to remove liquid.
Poly(phe-lys) was purchased from Sigma Chemicals, Inc. This polypeptide has a 1:1 molar ratio of phe:lys and an average m.w. of 47,900 gm/mole. It has an average length of 309 amino acids and contains 155 amines/mole. A 1 mg/ml solution of the polypeptide was mixed with 2M NaCl/1X PBS to a final concentration of 0.1 mg/ml (pH 6.0). 100 μL of this solution was added to each well. The plate was wrapped in plastic to prevent drying and incubated at 30° C. overnight. The plate was then washed 4 times with 1X PBS and the wells aspirated to remove liquid.
The following procedure was used to couple the oligonucleotide XT1* to the plates. Synthesis of XT1* was described in EPA 883096976. 20 mg disuccinimidyl suberate was dissolved in 300 μl dimethyl formamide (DMF). 26 OD260 units of XT1* was added to 100 μl coupling buffer (50 mM sodium phosphate, pH 7.8). The coupling mixture was then added to the DSS-DMF solution and stirred with a magnetic stirrer for 30 min. An NAP-25 column was equilibrated with 10 mM sodium phosphate, pH 6.5. The coupling mixture DSS-DMF solution was added to 2 ml 10 mM sodium phosphate, pH 6.5, at 4° C. The mixture was vortexed to mix and loaded onto the equilibrated NAP-25 column. DSS-activated XT1* DNA was eluted from the column with 3.5 ml 10 mM sodium phosphate, pH 6.5. 5.6 OD260 units of eluted DSS-activated XT1* DNA was added to 1500 ml 50 mM sodium phosphate, pH 7.8. 50 μl of this solution was added to each well and the plates were incubated overnight. The plate was then washed 4 times with 1X PBS and the wells aspirated to remove liquid.
Final stripping of plates was accomplished as follows. 200 μL of 0.2N NaOH containing 0.5% (w/v) SDS was added to each well. The plate was wrapped in plastic and incubated at 65° C. for 60 min. The plate was then washed 4 times with 1X PBS and the wells aspirated to remove liquid. The stripped plate was stored with desiccant beads at 2°-8° C.
The HAV-infected cell culture (100% HAV infected FRhK4 cell line) and the uninfected cell culture (FRhK4 cell line) were prepared as follows.
Cells were trypsinized in STV (equal parts 0.25% trypsin and 1:2000 versene (Sigma Chemical Co.) in PBS) and resuspended in 5 ml of the medium (DMEM with 20% FBS) the cells were grown in. The cells were then counted in a hemocytometer and diluted to 105 cells/10 μl, 104 cells/10 μl 103 cells/10 μl, and 102 cells/10 μl.
A cocktail of the HAV-specific amplifier and capture probes was prepared in a proteinase K solution prepared by first adding 10 mg proteinase K to 5 ml capture diluent (53 mM Tris-HCl, pH 8.0/10.6 mM EDTA/1.3% SDS/16 μg/ml sonicated salmon sperm DNA/5.3X SSC/1 mg/ml proteinase K/7% formamide). The cocktail contained 50 fmoles of each probe in 30 μl buffer. 30 μl of this solution was added to each well. 10 μl of the appropriate dilution of the uninfected and infected cells as described above was then added to each well. Plates were covered and agitated to mix samples, then incubated at 65° C. overnight.
The next morning the plates were cooled at room temperature for 10 minutes. The contents of each well were aspirated to remove all fluid, and the wells were washed 2X with washing buffer (0.1% SDS/0.015M NaCl/0.0015M sodium citrate). Amplifier multimer was then added to each well (20 fmoles/well in 4X SSC/0.1% SDS/0.5% Blocking Reagent (a purified fraction of dry milk powder, Boehringer Mannheim, catalog No. 1096 176)). After covering plates and agitating to mix the contents in the wells, the plates were incubated for 15 min at 65° C.
After a further 5-10 min period at room temperature, the wells were washed as described above.
Alkaline phosphatase label probe, disclosed in EP 883096976, was then added to each well (20 fmoles/well in 40 μl 4X SSC/0.1% SDS/0.5% Blocking Reagent). After incubation at 55° C. for 15 min, and 5-10 min at room temperature, the wells were washed twice as above and then 3x with 0.015M NACl/0.0015M sodium citrate.
An enzyme-triggered dioxetane (Schaap et al., Tet. Lett. 191987) 28:1159-1162 and EPA Pub. No. 0254051, obtained from Lumigen, Inc., was employed. The detection procedure was as follows. 30 μl Lumiphos 530 (Lumigen) was added to each well. The wells were tapped lightly so that the reagent would fall to the bottom and gently swirled to distribute the reagent evenly over the bottom. The wells were covered and incubated at 37° C. for 40 min.
Plates were then read on a Dynatech ML 1000 luminometer. Output was given as the full integral of the light produced during the reaction.
Results are shown in the Table below. Results for each standard sample are expressed as the difference between the mean of the negative control plus two standard deviations and the mean of the sample minus two standard deviations (delta). If delta is greater than zero, the sample is considered positive. These results indicate a sensitivity of about 103-10 4 HAV molecules.
              TABLE                                                       
______________________________________                                    
Sample            Amount  Delta                                           
______________________________________                                    
uninfected cells  10.sup.5                                                
                          --                                              
uninfected cells  10.sup.4                                                
                          -0.26                                           
uninfected cells  10.sup.3                                                
                          -0.25                                           
uninfected cells  10.sup.2                                                
                          -0.16                                           
HAV-infected cells                                                        
                  10.sup.5                                                
                          15.52                                           
HAV-infected cells                                                        
                  10.sup.4                                                
                          2.59                                            
HAV-infected cells                                                        
                  10.sup.3                                                
                          -0.09                                           
HAV-infected cells                                                        
                  10.sup.2                                                
                          -0.03                                           
______________________________________                                    
Modifications of the above-described modes for carrying out the invention that are obvious to those of skill in biochemistry, nucleic acid hybridization assays, and related fields are intended to be within the scope of the following claims.
__________________________________________________________________________
SEQUENCE LISTING                                                          
(1) GENERAL INFORMATION:                                                  
(iii) NUMBER OF SEQUENCES: 39                                             
(2) INFORMATION FOR SEQ ID NO:1:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 7 base pairs                                                  
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:                                   
TGACTGN7                                                                  
(2) INFORMATION FOR SEQ ID NO:2:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 26 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:                                   
CGTGTGGAGACACGGGTCCTATGCCT26                                              
(2) INFORMATION FOR SEQ ID NO:3:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 60 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:                                   
GATGTGGTTGTCGTACTTGATGTGGTTGTCGTACTTGATGTGGTTGTCGTACTTGCGTAG60            
(2) INFORMATION FOR SEQ ID NO:4:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 16 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:                                   
TCCACGAAAAAAAAAA16                                                        
(2) INFORMATION FOR SEQ ID NO:5:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 12 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:                                   
CAGTCACTACGC12                                                            
(2) INFORMATION FOR SEQ ID NO:6:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 33 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:                                   
ATAGAAGTATTAGCCTAAGAGGTTTCACCCGTA33                                       
(2) INFORMATION FOR SEQ ID NO:7:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 33 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:                                   
CCGCCGCTGTTRCCCTATCCAARGCATCTCTTC33                                       
(2) INFORMATION FOR SEQ ID NO:8:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 33 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:                                   
TGAATGGTTTTTGTCTTAACAACTCACCAATAT33                                       
(2) INFORMATION FOR SEQ ID NO:9:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 33 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:                                   
GCATCCACTGGATGAGAGYCAGTCCTCCGGCGT33                                       
(2) INFORMATION FOR SEQ ID NO:10:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 33 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:                                  
CTARAGACAGCCCTGACARTCAATCCACTCAAT33                                       
(2) INFORMATION FOR SEQ ID NO:11:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 33 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:                                  
TTGCCCTAAGCACAGAGAGGTCTGRRATTAARC33                                       
(2) INFORMATION FOR SEQ ID NO:12:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 33 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:                                  
TCTCACAGRATCCCATTTAAGGCCAAATGRTGT33                                       
(2) INFORMATION FOR SEQ ID NO:13:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 33 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:                                  
AAGAACAGTCCAGCTGTCAATGGAGGGAYCCCC33                                       
(2) INFORMATION FOR SEQ ID NO:14:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 33 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:                                  
GTACCTCAGAGGCAAACACCACATAAGGCCCCA33                                       
(2) INFORMATION FOR SEQ ID NO:15:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 33 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:                                  
TTTAAGAATGAGGAAAAACCTAAATGCCCCTGA33                                       
(2) INFORMATION FOR SEQ ID NO:16:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 33 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:                                  
GGAAAATWCCTTGTYTRGACATRTTCATTATTR33                                       
(2) INFORMATION FOR SEQ ID NO:17:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 33 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:                                  
ACAGGATGTGGTCAAGRCCACTCCCRACAGTCT33                                       
(2) INFORMATION FOR SEQ ID NO:18:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 33 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:                                  
GAATCATTTGCTCTTCCTCAATRTCTGCCAAAG33                                       
(2) INFORMATION FOR SEQ ID NO:19:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 33 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:                                  
AAGCWCCAGTCACTGCAGTCCTAWCAACKGAYT33                                       
(2) INFORMATION FOR SEQ ID NO:20:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 33 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:                                  
GAACTGAAGATTGRTCCACAGAAGTRAARTAAG33                                       
(2) INFORMATION FOR SEQ ID NO:21:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 33 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:                                  
GTTCAAYYTGRTGTRAKCCAACCTCAGCWGTAT33                                       
(2) INFORMATION FOR SEQ ID NO:22:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 33 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:                                  
TWGAACYRGGTTTATCAACAGAGGTTYTCAARG33                                       
(2) INFORMATION FOR SEQ ID NO:23:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 33 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:                                  
GAATCARGAAAAAYTTYTCYCCCTGAGTYYTCT33                                       
(2) INFORMATION FOR SEQ ID NO:24:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 33 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:                                  
ADAGAGCATGTGTAGTRAGCCAATCWGCAGAAT33                                       
(2) INFORMATION FOR SEQ ID NO:25:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 33 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:                                  
RTTTCACCACRTCCAATTTTGCAACTTCATGRA33                                       
(2) INFORMATION FOR SEQ ID NO:26:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 33 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:26:                                  
AMCCTTGRACRGCAAACTGCTCATTRTAYARTA33                                       
(2) INFORMATION FOR SEQ ID NO:27:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 33 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:27:                                  
TGCCAAATCTTGCATATGTRTGGTATCTCAACA33                                       
(2) INFORMATION FOR SEQ ID NO:28:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 33 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:28:                                  
CGCAACGGCCAGAGCCTAGGGCAAGGGGAGAGC33                                       
(2) INFORMATION FOR SEQ ID NO:29:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 33 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:29:                                  
CTCCATGCTAATCATGGAGTTGACCCCGCCGGG33                                       
(2) INFORMATION FOR SEQ ID NO:30:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 33 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:30:                                  
AMACATCTGYGTCCCCAATTTAGACTCCTACAG33                                       
(2) INFORMATION FOR SEQ ID NO:31:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 33 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:31:                                  
GARAGCCAAGTTWACACTGCAAGGTGACGTYCC33                                       
(2) INFORMATION FOR SEQ ID NO:32:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 33 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:32:                                  
GCCTACCCCTTGTGGAAGATCAAAGAGRTTCAT33                                       
(2) INFORMATION FOR SEQ ID NO:33:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 33 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:33:                                  
ARGGTGTRGGRTTTATCTGAACTTGAATYTCAA33                                       
(2) INFORMATION FOR SEQ ID NO:34:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 33 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:34:                                  
GAACCATRGCACARATYARYCCYCCYTGYTGRA33                                       
(2) INFORMATION FOR SEQ ID NO:35:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 33 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:35:                                  
AKGATGCTATHGAACCATARCTYTGGTCACYAG33                                       
(2) INFORMATION FOR SEQ ID NO:36:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 33 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:36:                                  
TGCAATTTAACARACCATGAGGATAAACAGTCA33                                       
(2) INFORMATION FOR SEQ ID NO:37:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 33 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:37:                                  
ATGGAACCTTTATTCTAACYACATTGTTRATRT33                                       
(2) INFORMATION FOR SEQ ID NO:38:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 20 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:38:                                  
AGGCATAGGACCCGTGTCTT20                                                    
(2) INFORMATION FOR SEQ ID NO:39:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 20 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:39:                                  
CTTCTTTGGAGAAAGTGGTG20                                                    
__________________________________________________________________________

Claims (20)

We claim:
1. A synthetic oligonucleotide useful as an amplifier probe in a sandwich hybridization assay for HAV (Hepatitis A Virus), wherein said oligonucleotide consists of:
a first segment having a minimum length of 25 nucleotides and a maximum length of 100 nucleotides which segment is at least 90% homologous to a segment of HAV nucleic acid, wherein said first segment comprises a nucleotide sequence selected from the group consisting of SEQ ID NOS: 6-27; and
a second segment consisting of a nucleotide sequence which is at least 90% homologous to an oligonucleotide segment of a nucleic acid multimer wherein said second segment is not complementary to HAV nucleic acid;
and optionally one or more noncomplementary segments each consisting of a nucleotide sequence that is not complementary to HAV nucleic acid.
2. The synthetic oligonucleotide of claim 1, wherein said second segment comprises SEQ ID NO:38.
3. The synthetic oligonucleotide of claim 1, wherein said first segment consists of a nucleotide sequence selected from the group consisting of SEQ ID NOS: 6-27.
4. A synthetic oligonucleotide useful as a capture probe in a sandwich hybridization assay for HAV, wherein the synthetic oligonucleotide consists of:
a first segment having a minimum length of 25 nucleotides and a maximum length of 100 nucleotides which segment is at least 90% homologous to a segment of HAV nucleic acid, wherein said first segment comprises a nucleotide sequence selected from the group consisting of SEQ ID NOS; 28-37; and
a second segment consisting of a nucleotide sequence which is at least 90% homologous to an oligonucleotide bound to a solid phase wherein said second segment is not complementary to HAV nucleic acid;
and optionally one or more noncomplementary segments each consisting of a nucleotide sequence that is not complementary to HAV nucleic acid.
5. The synthetic oligonucleotide of claim 4, wherein said second segment comprises SEQ ID NO:39.
6. The synthetic oligonucleotide of claim 4, wherein said first segment consists of a nucleotide sequence selected from the group consisting of SEQ ID NOS: 28-37.
7. A set of synthetic oligonucleotides useful as amplifier probes in a sandwich hybridization assay for HAV, comprising at least two different oligonucleotide probes, wherein each oligonucleotide probe consists of:
a first segment having a minimum length of 25 nucleotides and a maximum length of 100 nucleotides which segment is at least 90% homologous to a segment of HAV nucleic acid, wherein said first segment comprises a nucleotide sequence selected from the group consisting of SEQ ID NOS: 6-27; and
a second segment consisting of a nucleotide sequence which is at least 90% homologous to an oligonucleotide segment of a nucleic acid multimer wherein said second segment is not complementary to HAV nucleic acid;
and optionally one or more noncomplementary segments each consisting of a nucleotide sequence that is not complementary to HAV nucleic acid.
8. The set of synthetic oligonucleotides of claim 7, wherein each said second segment comprises SEQ ID NO:38.
9. The set of synthetic oligonucleotides of claim 7, wherein said set comprises at least five different oligonucleotide probes.
10. The set of synthetic oligonucleotides of claim 7, wherein each of said first segments consists of a nucleotide sequence selected from the group consisting of SEQ ID NOS: 6-27.
11. A set of synthetic oligonucleotides useful as capture probes in a sandwich hybridization assay for HAV, comprising at least two different oligonucleotide probes, wherein each oligonucleotide probe consists of:
a first segment having a minimum length of 25 nucleotides and a maximum length of 100 nucleotides which segment is at least 90% homologous to a segment of HAV nucleic acid, wherein said first segment comprises a nucleotide sequence selected from the group consisting of SEQ ID NOS: 28-37; and
a second segment consisting of a nucleotide sequence which is at least 90% homologous to an oligonucleotide bound to a solid phase wherein said second segment is not complementary to HAV nucleic acid;
and optionally one or more noncomplementary segments each consisting of a nucleotide sequence that is not complementary to HAV nucleic acid.
12. The set of synthetic oligonucleotides of claim 11, wherein each said second segment comprises SEQ ID NO:39.
13. The set of synthetic oligonucleotides of claim 11, wherein said set comprises at least five different oligonucleotide probes.
14. The set of synthetic oligonucleotides of claim 11, wherein each of said first segments consists of a nucleotide sequence selected from the group consisting of SEQ ID NOS: 28-37.
15. A solution sandwich hybridization assay for detecting the presence of HAV in a sample, comprising
(a) contacting the sample with (i) amplifier probes comprising the set of synthetic oligonucleotides of claim 7 and (ii) a set of capture probe oligonucleotides wherein there is a molar excess of amplifier probes and of capture probes over analyte nucleic acid in the sample, wherein said set of capture probe oligonucleotides comprises at least two different oligonucleotides each of which consists of
a first segment having a minimum length of 25 nucleotides and a maximum length of 100 nucleotides which segment is at least 90% homologous to a segment of HAV nucleic acid, wherein said first segment comprises a nucleotide sequence selected from the group consisting of SEQ ID NOS: 28-37; and
a second segment consisting of a nucleotide sequence which is at least 90% homologous to an oligonucleotide bound to a solid phase wherein said second segment is not complementary to HAV nucleic acid;
and optionally one or more noncomplementary segments each consisting of a nucleotide sequence that is not complementary to HAV nucleic acid;
(b) contacting the product of step (a) with said oligonucleotide bound to the solid phase;
(c) thereafter separating materials not bound to the solid phase;
(d) contacting the bound product of step (c) with a nucleic acid multimer, said multimer comprising at least one oligonucleotide segment that is at least 90% homologous to the second segment of the amplifier probe polynucleotide and a multiplicity of second oligonucleotide segments that are at least 90% homologous to a labeled oligonucleotide;
(e) removing unbound multimer;
(f) contacting the solid phase complex product of step (e) with the labeled oligonucleotide;
(g) removing unbound labeled oligonucleotide; and
(h) detecting the presence of label in the solid phase complex product of step (g) and, thereby, detecting the presence of virus in the sample.
16. The assay of claim 15, wherein said set of amplifier probes comprises at least five different oligonucleotide probes.
17. The assay of claim 15, wherein said set of capture probes comprises at least five different oligonucleotide probes.
18. A kit for the detection of HAV in a sample comprising in combination
(i) a set of amplifier probe oligonucleotides comprising the set of oligonucleotides of claim 7;
(ii) a set of capture probe oligonucleotides comprising at least two different oligonucleotides each of which consists of
a first segment having a minimum length of 25 nucleotides and a maximum length of 100 nucleotides which segment is at least 90% homologous to a segment of HAY nucleic acid, wherein said first segment comprises a nucleotide sequence selected from the group consisting of SEQ ID NOS: 28-37; and
a second segment consisting of a nucleotide sequence which is at least 90% homologous to an oligonucleotide bound to a solid phase wherein said second segment is not complementary to HAV nucleic acid;
and optionally one or more noncomplementary segments each consisting of a nucleotide sequence that is not complementary to HAV nucleic acid;
(iii) a nucleic acid multimer, said multimer comprising at least one oligonucleotide segment that is at least 90% homologous to the second segment of the amplifier probe polynucleotide and a multiplicity of second oligonucleotide segments that are at least 90% homologous to a labeled oligonucleotide; and
(iv) a labeled oligonucleotide.
19. The kit of claim 18, wherein said set of amplifier probes comprises at least five different oligonucleotide probes.
20. The kit of claim 18, wherein said set of capture probes comprises at least five different oligonucleotide probes.
US08/417,476 1991-12-23 1995-04-05 HAV probes for use in solution phase sandwich hybridization and assays for detecting the presence of HAV Expired - Fee Related US5702891A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US08/417,476 US5702891A (en) 1991-12-23 1995-04-05 HAV probes for use in solution phase sandwich hybridization and assays for detecting the presence of HAV

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US81358991A 1991-12-23 1991-12-23
US08/417,476 US5702891A (en) 1991-12-23 1995-04-05 HAV probes for use in solution phase sandwich hybridization and assays for detecting the presence of HAV

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US81358991A Continuation 1991-12-23 1991-12-23

Publications (1)

Publication Number Publication Date
US5702891A true US5702891A (en) 1997-12-30

Family

ID=25212840

Family Applications (1)

Application Number Title Priority Date Filing Date
US08/417,476 Expired - Fee Related US5702891A (en) 1991-12-23 1995-04-05 HAV probes for use in solution phase sandwich hybridization and assays for detecting the presence of HAV

Country Status (6)

Country Link
US (1) US5702891A (en)
EP (1) EP0672175A4 (en)
JP (1) JPH07502658A (en)
AU (1) AU3427993A (en)
CA (1) CA2125269A1 (en)
WO (1) WO1993013226A1 (en)

Cited By (29)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030171335A1 (en) * 2001-10-16 2003-09-11 Stein David A. Antisense antiviral agent and method for treating ssRNA viral infection
WO2002092847A3 (en) * 2001-05-16 2003-11-20 Arc Austrian Res Centers Gmbh Method for analysing dna of sweetpotato
US20030224353A1 (en) * 2001-10-16 2003-12-04 Stein David A. Antisense antiviral agent and method for treating ssRNA viral infection
US20040072150A1 (en) * 2002-06-12 2004-04-15 Venkatakrishna Shyamala Identification of oligonucleotides for the capture, detection and quantitation of hepatitis A viral nucleic acid
US20060014142A1 (en) * 2004-07-13 2006-01-19 Gen-Probe Incorporated Compositions and methods for detection of hepatitis A virus nucleic acid
US20060063150A1 (en) * 2004-09-16 2006-03-23 Iversen Patrick L Antisense antiviral compound and method for treating ssRNA viral infection
US20060240032A1 (en) * 2005-03-31 2006-10-26 Hinrichs David J Immunomodulating compositions and methods for use in the treatment of human autoimmune diseases
US20070066556A1 (en) * 2005-09-08 2007-03-22 Stein David A Antisense antiviral compound and method for treating picornavirus infection
US20070129323A1 (en) * 2005-09-08 2007-06-07 Stein David A Antisense antiviral compound and method for treating picornavirus infection
US20070265214A1 (en) * 2006-05-10 2007-11-15 Stein David A Antisense antiviral agent and method for treating ssRNA viral infection
US20080187993A1 (en) * 2003-10-23 2008-08-07 Avi Biopharma, Inc. Method and antisense composition for selective inhibition of hiv infection in hematopoietic cells
US20080311556A1 (en) * 2003-08-07 2008-12-18 Iversen Patrick L Sense Antiviral Compound and Method for Treating Ssrna Viral Infection
US20090088562A1 (en) * 2006-05-10 2009-04-02 Weller Dwight D Oligonucleotide analogs having cationic intersubunit linkages
US20090110689A1 (en) * 2005-11-08 2009-04-30 Avi Biopharma, Inc. Immunosuppression compound and treatment method
US20090186849A1 (en) * 2004-11-01 2009-07-23 Stein David A Antisense antiviral compounds and methods for treating a filovirus infection
US20100184670A1 (en) * 2008-12-17 2010-07-22 Mourich Dan V Antisense compositions and methods for modulating contact hypersensitivity or contact dermatitis
CN101838710A (en) * 2010-06-04 2010-09-22 湖州市疾病预防控制中心 Hepatitis A virus nucleic acid fluorescence quantitative RT-PRC assay kit and using method thereof
US8198429B2 (en) 2010-08-09 2012-06-12 Avi Biopharma, Inc. Antisense antiviral compounds and methods for treating a filovirus infection
US8357664B2 (en) 2004-10-26 2013-01-22 Avi Biopharma, Inc. Antisense antiviral compound and method for treating influenza viral infection
US20130078641A1 (en) * 2010-06-01 2013-03-28 Streck, Inc. Sample processing method and device
US8697858B2 (en) 2009-11-13 2014-04-15 Sarepta Therapeutics, Inc. Antisense antiviral compound and method for treating influenza viral infection
EP2643461A4 (en) * 2011-09-07 2014-05-07 Grifols Therapeutics Inc METHODS, COMPOSITIONS AND KITS FOR DETECTION OF HEPATITIS A VIRUS
US8779128B2 (en) 2010-05-28 2014-07-15 Sarepta Therapeutics, Inc. Oligonucleotide analogues having modified intersubunit linkages and/or terminal groups
WO2014144578A1 (en) * 2013-03-15 2014-09-18 The Usa, As Represented By The Secretary, Department Of Health And Human Services Selective detection of hepatitis a, b, c, d, or e viruses or combinations thereof
US9249243B2 (en) 2005-07-13 2016-02-02 Sarepta Therapeutics, Inc. Antibacterial antisense oligonucleotide and method
US9278987B2 (en) 2011-11-18 2016-03-08 Sarepta Therapeutics, Inc. Functionally-modified oligonucleotides and subunits thereof
US10017763B2 (en) 2010-09-03 2018-07-10 Sarepta Therapeutics, Inc. dsRNA molecules comprising oligonucleotide analogs having modified intersubunit linkages and/or terminal groups
US10457938B2 (en) * 2013-06-14 2019-10-29 Deutsches Krebsforschungszentrum TTV miRNA sequences as an early marker for the future development of cancer and as a target for cancer treatment and prevention
US11020417B2 (en) 2015-06-04 2021-06-01 Sarepta Therapeutics, Inc Methods and compounds for treatment of lymphocyte-related diseases and conditions

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2126952C (en) * 1994-06-28 2010-12-14 Sithian Pandian Probe, kit, and method of amplification for increasing the sensitivity of nucleic acid hybridization assays
GB0016813D0 (en) 2000-07-07 2000-08-30 Lee Helen Improved dipstick assays (4)
EP2743355B1 (en) * 2012-12-13 2016-08-10 F. Hoffmann-La Roche AG HAV detection

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4828979A (en) * 1984-11-08 1989-05-09 Life Technologies, Inc. Nucleotide analogs for nucleic acid labeling and detection
US4868105A (en) * 1985-12-11 1989-09-19 Chiron Corporation Solution phase nucleic acid sandwich assay
US4894228A (en) * 1982-04-07 1990-01-16 The United States Of America As Represented By The Department Of Health And Human Services Vaccine against hepatitis A virus
US4894325A (en) * 1984-04-27 1990-01-16 Enzo Biochem, Inc. Hybridization method for the detection of genetic material
WO1992002526A1 (en) * 1990-07-27 1992-02-20 Chiron Corporation Large comb-type branched polynucleotides
US5124246A (en) * 1987-10-15 1992-06-23 Chiron Corporation Nucleic acid multimers and amplified nucleic acid hybridization assays using same
US5175270A (en) * 1986-09-10 1992-12-29 Polyprobe, Inc. Reagents for detecting and assaying nucleic acid sequences

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA1339351C (en) * 1987-10-15 1997-08-26 Michael S. Urdea Nucleic acid multimers and amplified nucleic acid hybridization assays using same

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4894228A (en) * 1982-04-07 1990-01-16 The United States Of America As Represented By The Department Of Health And Human Services Vaccine against hepatitis A virus
US4894325A (en) * 1984-04-27 1990-01-16 Enzo Biochem, Inc. Hybridization method for the detection of genetic material
US4828979A (en) * 1984-11-08 1989-05-09 Life Technologies, Inc. Nucleotide analogs for nucleic acid labeling and detection
US4868105A (en) * 1985-12-11 1989-09-19 Chiron Corporation Solution phase nucleic acid sandwich assay
US5175270A (en) * 1986-09-10 1992-12-29 Polyprobe, Inc. Reagents for detecting and assaying nucleic acid sequences
US5124246A (en) * 1987-10-15 1992-06-23 Chiron Corporation Nucleic acid multimers and amplified nucleic acid hybridization assays using same
WO1992002526A1 (en) * 1990-07-27 1992-02-20 Chiron Corporation Large comb-type branched polynucleotides

Non-Patent Citations (24)

* Cited by examiner, † Cited by third party
Title
Brown et al., "Characterization of a simian hepatitis A virus (HAV): antigenic and genetic comparison with human HAV" J. Virol. (1989) 63(11):4932-4937.
Brown et al., Characterization of a simian hepatitis A virus (HAV): antigenic and genetic comparison with human HAV J. Virol. (1989) 63(11):4932 4937. *
Cohen et al. (1987) "Complete Nucleotide Sequence of Wild-type Hepatitis A Virus: Comparison with Different Strains of Hepatitis A Virus and Other Picornaviruses", J. of Virology, vol. 61, No. 1, pp. 50-59.
Cohen et al. (1987) Complete Nucleotide Sequence of Wild type Hepatitis A Virus: Comparison with Different Strains of Hepatitis A Virus and Other Picornaviruses , J. of Virology, vol. 61, No. 1, pp. 50 59. *
Jansen et al., "Combined immunoaffinity cDNA-RNA hybridization assay for detection of hepatitis A virus in clinical specimens" J. Clin. Microbiol. (1985) 22(6):984-989.
Jansen et al., Combined immunoaffinity cDNA RNA hybridization assay for detection of hepatitis A virus in clinical specimens J. Clin. Microbiol. (1985) 22(6):984 989. *
Jiang et al., "Detection of hepatitis A virus by hybridization with single-stranded RNA probes" Appl. and Environ. Microbiol. (1987) 53(10):2487-2495.
Jiang et al., "Detection of hepatitis A virus in seeded estuarine samples by hybridization with cDNA probes" Appl. and Environ. Microbiol. (1986) 52(4):711-717.
Jiang et al., "In situ hybridization for quantitative assay of infectious hepatitis A virus" J. Clin. Mirobiol. (1989) 27(5):874-879.
Jiang et al., Detection of hepatitis A virus by hybridization with single stranded RNA probes Appl. and Environ. Microbiol. (1987) 53(10):2487 2495. *
Jiang et al., Detection of hepatitis A virus in seeded estuarine samples by hybridization with cDNA probes Appl. and Environ. Microbiol. (1986) 52(4):711 717. *
Jiang et al., In situ hybridization for quantitative assay of infectious hepatitis A virus J. Clin. Mirobiol. (1989) 27(5):874 879. *
Lemon et al., "Genomic heterogeneity among human and nonhuman strains of hepatitis A virus" J. Virol. (1987) 61(3):735-742.
Lemon et al., Genomic heterogeneity among human and nonhuman strains of hepatitis A virus J. Virol. (1987) 61(3):735 742. *
Linemeyer et al., "Molecular cloning and partial sequencing of hepatitis A viral cDNA" J. Virol. (1985) 54(2):247-255.
Linemeyer et al., Molecular cloning and partial sequencing of hepatitis A viral cDNA J. Virol. (1985) 54(2):247 255. *
Ross et al., "Molecular cloning of cDNA form hepatitis A virus strain HM-175 after multiple passages in vivo and in vitro" J. Gen. Virol. (1986) 67,1741-1744.
Ross et al., Molecular cloning of cDNA form hepatitis A virus strain HM 175 after multiple passages in vivo and in vitro J. Gen. Virol. (1986) 67,1741 1744. *
Shieh et al., "Detection of hepatitis A virus and other enteroviruses in water by ssRNA probes" J. Virol. Meth. (1991) 31:119-120.
Shieh et al., Detection of hepatitis A virus and other enteroviruses in water by ssRNA probes J. Virol. Meth. (1991) 31:119 120. *
Ticehurst et al., "Molecular cloning and characterization of hepatitis A virus cDNA" Proc. Natl. Acad. Sci. (1983) 80:5885-5889.
Ticehurst et al., Molecular cloning and characterization of hepatitis A virus cDNA Proc. Natl. Acad. Sci. (1983) 80:5885 5889. *
Von Der Helm et al., "Cloning of hepatitis A virus genome" J. Virol. Meth. (1981) 3:37-43.
Von Der Helm et al., Cloning of hepatitis A virus genome J. Virol. Meth. (1981) 3:37 43. *

Cited By (75)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002092847A3 (en) * 2001-05-16 2003-11-20 Arc Austrian Res Centers Gmbh Method for analysing dna of sweetpotato
US20040235009A1 (en) * 2001-05-16 2004-11-25 Austria Research Centers Gmbh-Arc Method for analyzing DNA of sweet potato
US20030224353A1 (en) * 2001-10-16 2003-12-04 Stein David A. Antisense antiviral agent and method for treating ssRNA viral infection
WO2003033657A3 (en) * 2001-10-16 2004-05-13 Avi Biopharma Inc Antisense antiviral agent and method for treating ssrna viral infection
US6828105B2 (en) 2001-10-16 2004-12-07 Avi Biopharma, Inc. Antisense antiviral agent and method for treating ssRNA viral infection
US20030171335A1 (en) * 2001-10-16 2003-09-11 Stein David A. Antisense antiviral agent and method for treating ssRNA viral infection
US20040072150A1 (en) * 2002-06-12 2004-04-15 Venkatakrishna Shyamala Identification of oligonucleotides for the capture, detection and quantitation of hepatitis A viral nucleic acid
WO2003106641A3 (en) * 2002-06-12 2004-10-14 Chiron Corp Identification of oligonucleotides for the capture, detection and quantitation of hepatitis a viral nucleic acid
RU2406762C2 (en) * 2002-06-12 2010-12-20 Новартис Вэксинес Энд Дайэгностикс, Инк. Set of two primers for amplifying nucleic acid of hepatitis a virus, method of detecting hepatitis a virus using said set (versions) and kit for detecting hepatitis a virus
AU2003276719B2 (en) * 2002-06-12 2009-03-12 Grifols Worldwide Operations Limited Identification of oligonucleotides for the capture, detection and quantitation of hepatitis A viral nucleic acid
US20080311556A1 (en) * 2003-08-07 2008-12-18 Iversen Patrick L Sense Antiviral Compound and Method for Treating Ssrna Viral Infection
US8008469B2 (en) 2003-10-23 2011-08-30 Avi Biopharma Inc. Antisense compound for inducing immunological tolerance
US20080187993A1 (en) * 2003-10-23 2008-08-07 Avi Biopharma, Inc. Method and antisense composition for selective inhibition of hiv infection in hematopoietic cells
US20090111977A1 (en) * 2003-10-23 2009-04-30 Avi Biopharma, Inc. Antisense compound for inducing immunological tolerance
US8063197B2 (en) 2004-07-13 2011-11-22 Gen-Probe Incorporated Compositions and methods for detection of hepatitis A virus nucleic acid
US7544792B2 (en) 2004-07-13 2009-06-09 Gen-Probe Incorporated Compositions and methods for detection of hepatitis A virus nucleic acid
US10392656B2 (en) 2004-07-13 2019-08-27 Gen-Probe Incorporated Compositions and methods for detection of hepatitis A virus nucleic acid
US9469881B2 (en) 2004-07-13 2016-10-18 Gen-Probe Incorporated Compositions and methods for detection of hepatitis A virus nucleic acid
US20060014142A1 (en) * 2004-07-13 2006-01-19 Gen-Probe Incorporated Compositions and methods for detection of hepatitis A virus nucleic acid
US20090208968A1 (en) * 2004-07-13 2009-08-20 Carlson James D Compositions and methods for detection of hepatitis a virus nucleic acid
US8563707B2 (en) 2004-07-13 2013-10-22 Gen-Probe Incorporated Compositions and methods for detection of hepatitis A virus nucleic acid
US8461324B2 (en) 2004-07-13 2013-06-11 Gen-Probe Incorporated Compositions and methods for detection of hepatitis A virus nucleic acid
EP2402465A3 (en) * 2004-07-13 2012-04-18 Gen-Probe Incorporated Compositions and methods for detection of Hepatitis A virus nucleic acid
US8129352B2 (en) 2004-09-16 2012-03-06 Avi Biopharma, Inc. Antisense antiviral compound and method for treating ssRNA viral infection
US8084433B2 (en) 2004-09-16 2011-12-27 Avi Biopharma, Inc. Antisense antiviral compound and method for treating ssRNA viral infection
US20060063150A1 (en) * 2004-09-16 2006-03-23 Iversen Patrick L Antisense antiviral compound and method for treating ssRNA viral infection
US10479996B2 (en) 2004-09-16 2019-11-19 Sarepta Therapeutics, Inc. Antisense antiviral compound and method for treating ss/RNA viral infection
US20060269911A1 (en) * 2004-09-16 2006-11-30 Avi Biopharma, Inc. Antisense antiviral compound and method for treating ssRNA viral infection
US8906872B2 (en) 2004-09-16 2014-12-09 Sarepta Therapeutics, Inc. Antisense antiviral compound and method for treating ssRNA viral infection
US8357664B2 (en) 2004-10-26 2013-01-22 Avi Biopharma, Inc. Antisense antiviral compound and method for treating influenza viral infection
US8168604B2 (en) 2004-11-01 2012-05-01 Avi Biopharma Inc. Antisense antiviral compounds and methods for treating a filovirus infection
US8030292B2 (en) 2004-11-01 2011-10-04 Avi Biopharma Inc. Antisense antiviral compounds and methods for treating a filovirus infection
US8030291B2 (en) 2004-11-01 2011-10-04 Avi Biopharma Inc. Antisense antiviral compounds and methods for treating a filovirus infection
US20090186848A1 (en) * 2004-11-01 2009-07-23 Stein David A Antisense antiviral compounds and methods for treating a filovirus infection
US20090186847A1 (en) * 2004-11-01 2009-07-23 Stein David A Antisense antiviral compounds and methods for treating a filovirus infection
US20090186849A1 (en) * 2004-11-01 2009-07-23 Stein David A Antisense antiviral compounds and methods for treating a filovirus infection
US20060240032A1 (en) * 2005-03-31 2006-10-26 Hinrichs David J Immunomodulating compositions and methods for use in the treatment of human autoimmune diseases
US9249243B2 (en) 2005-07-13 2016-02-02 Sarepta Therapeutics, Inc. Antibacterial antisense oligonucleotide and method
US20070066556A1 (en) * 2005-09-08 2007-03-22 Stein David A Antisense antiviral compound and method for treating picornavirus infection
US20070129323A1 (en) * 2005-09-08 2007-06-07 Stein David A Antisense antiviral compound and method for treating picornavirus infection
US8329668B2 (en) 2005-09-08 2012-12-11 Avi Biopharma, Inc. Antisense antiviral compound and method for treating picornavirus infection
US8524676B2 (en) 2005-09-08 2013-09-03 Sarepta Therapeutics, Inc. Method for treating enterovirus or rhinovirus infection using antisense antiviral compounds
US20090110689A1 (en) * 2005-11-08 2009-04-30 Avi Biopharma, Inc. Immunosuppression compound and treatment method
US9487786B2 (en) 2005-11-08 2016-11-08 Sarepta Therapeutics, Inc. Immunosuppression compound and treatment method
US8501704B2 (en) 2005-11-08 2013-08-06 Sarepta Therapeutics, Inc. Immunosuppression compound and treatment method
US8933216B2 (en) 2005-11-08 2015-01-13 Sarepta Therapeutics, Inc. Immunosuppression compound and treatment method
US7943762B2 (en) 2006-05-10 2011-05-17 Avi Biopharma, Inc. Oligonucleotide analogs having cationic intersubunit linkages
US20070265214A1 (en) * 2006-05-10 2007-11-15 Stein David A Antisense antiviral agent and method for treating ssRNA viral infection
US20090088562A1 (en) * 2006-05-10 2009-04-02 Weller Dwight D Oligonucleotide analogs having cationic intersubunit linkages
US8785407B2 (en) 2006-05-10 2014-07-22 Sarepta Therapeutics, Inc. Antisense antiviral agent and method for treating ssRNA viral infection
US8592386B2 (en) 2008-12-17 2013-11-26 Sarepta Therapeutics, Inc. Antisense compositions and methods for modulating contact hypersensitivity or contact dermatitis
US20100184670A1 (en) * 2008-12-17 2010-07-22 Mourich Dan V Antisense compositions and methods for modulating contact hypersensitivity or contact dermatitis
US8697858B2 (en) 2009-11-13 2014-04-15 Sarepta Therapeutics, Inc. Antisense antiviral compound and method for treating influenza viral infection
US9394323B2 (en) 2009-11-13 2016-07-19 Sarepta Therapeutics, Inc. Antisense antiviral compound and method for treating influenza viral infection
US8779128B2 (en) 2010-05-28 2014-07-15 Sarepta Therapeutics, Inc. Oligonucleotide analogues having modified intersubunit linkages and/or terminal groups
US9469664B2 (en) 2010-05-28 2016-10-18 Sarepta Therapeutics, Inc. Oligonucleotide analogues having modified intersubunit linkages and/or terminal groups
US10760078B2 (en) 2010-05-28 2020-09-01 Sarepta Therapeutics, Inc. Oligonucleotide analogues having modified intersubunit linkages and/or terminal groups
US10202602B2 (en) 2010-05-28 2019-02-12 Sarepta Therapeutics, Inc. Oligonucleotide analogues having modified intersubunit linkages and/or terminal groups
US20130078641A1 (en) * 2010-06-01 2013-03-28 Streck, Inc. Sample processing method and device
CN101838710A (en) * 2010-06-04 2010-09-22 湖州市疾病预防控制中心 Hepatitis A virus nucleic acid fluorescence quantitative RT-PRC assay kit and using method thereof
US8524684B2 (en) 2010-08-09 2013-09-03 Avi Biopharma, Inc. Antisense antiviral compounds and methods for treating a filovirus infection
US9382536B2 (en) 2010-08-09 2016-07-05 Sarepta Therapeutics, Inc. Antisense antiviral compounds and methods for treating a filovirus infection
US8703735B2 (en) 2010-08-09 2014-04-22 Sarepta Therapeutics, Inc. Antisense antiviral compounds and methods for treating a filovirus infection
US8198429B2 (en) 2010-08-09 2012-06-12 Avi Biopharma, Inc. Antisense antiviral compounds and methods for treating a filovirus infection
US9982261B2 (en) 2010-08-09 2018-05-29 Sarepta Therapeutics, Inc. Antisense antiviral compounds and methods for treating a filovirus infection
US10017763B2 (en) 2010-09-03 2018-07-10 Sarepta Therapeutics, Inc. dsRNA molecules comprising oligonucleotide analogs having modified intersubunit linkages and/or terminal groups
US11072793B2 (en) 2010-09-03 2021-07-27 Sarepta Therapeutics, Inc. DsRNA molecules comprising oligonucleotide analogs having modified intersubunit linkages and/or terminal groups
EP2643461A4 (en) * 2011-09-07 2014-05-07 Grifols Therapeutics Inc METHODS, COMPOSITIONS AND KITS FOR DETECTION OF HEPATITIS A VIRUS
US9790499B2 (en) 2011-11-18 2017-10-17 Sarepta Therapeutics, Inc. Functionally-modified oligonucleotides and subunits thereof
US10344281B2 (en) 2011-11-18 2019-07-09 Sarepta Therapeutics, Inc. Functionally-modified oligonucleotides and subunits thereof
US9278987B2 (en) 2011-11-18 2016-03-08 Sarepta Therapeutics, Inc. Functionally-modified oligonucleotides and subunits thereof
US11208655B2 (en) 2011-11-18 2021-12-28 Sarepta Therapeutics, Inc. Functionally-modified oligonucleotides and subunits thereof
WO2014144578A1 (en) * 2013-03-15 2014-09-18 The Usa, As Represented By The Secretary, Department Of Health And Human Services Selective detection of hepatitis a, b, c, d, or e viruses or combinations thereof
US10457938B2 (en) * 2013-06-14 2019-10-29 Deutsches Krebsforschungszentrum TTV miRNA sequences as an early marker for the future development of cancer and as a target for cancer treatment and prevention
US11020417B2 (en) 2015-06-04 2021-06-01 Sarepta Therapeutics, Inc Methods and compounds for treatment of lymphocyte-related diseases and conditions

Also Published As

Publication number Publication date
EP0672175A4 (en) 1997-08-06
JPH07502658A (en) 1995-03-23
CA2125269A1 (en) 1993-07-08
AU3427993A (en) 1993-07-28
WO1993013226A1 (en) 1993-07-08
EP0672175A1 (en) 1995-09-20

Similar Documents

Publication Publication Date Title
US5702891A (en) HAV probes for use in solution phase sandwich hybridization and assays for detecting the presence of HAV
US6300056B1 (en) HIV probes for use in solution phase sandwich hybridization assays
US5736316A (en) HBV capture and amplifiers probes for use in solution phase sandwich hybridization assays
US5849481A (en) Nucleic acid hybridization assays employing large comb-type branched polynucleotides
US5407795A (en) CMV probes for use in solution phase sandwich
US6235465B1 (en) HTLV-1 probes for use in solution phase sandwich hybridization assays
US5747244A (en) Nucleic acid probes immobilized on polystyrene surfaces
US5635352A (en) Solution phase nucleic acid sandwich assays having reduced background noise
US5618674A (en) Chlamydiae probes for use in solution phase sandwich hybridization assays
EP0541693B1 (en) Large comb-type branched polynucleotides

Legal Events

Date Code Title Description
AS Assignment

Owner name: CHIRON DIAGNOSTICS CORPORATION, MASSACHUSETTS

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:CHIRON CORPORATION;REEL/FRAME:009678/0915

Effective date: 19990122

FEPP Fee payment procedure

Free format text: PAYOR NUMBER ASSIGNED (ORIGINAL EVENT CODE: ASPN); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

FPAY Fee payment

Year of fee payment: 4

REMI Maintenance fee reminder mailed
LAPS Lapse for failure to pay maintenance fees
STCH Information on status: patent discontinuation

Free format text: PATENT EXPIRED DUE TO NONPAYMENT OF MAINTENANCE FEES UNDER 37 CFR 1.362

FP Lapsed due to failure to pay maintenance fee

Effective date: 20051230

OSZAR »