US5856104A - Polymorphisms in the glucose-6 phosphate dehydrogenase locus - Google Patents

Polymorphisms in the glucose-6 phosphate dehydrogenase locus Download PDF

Info

Publication number
US5856104A
US5856104A US08/813,508 US81350897A US5856104A US 5856104 A US5856104 A US 5856104A US 81350897 A US81350897 A US 81350897A US 5856104 A US5856104 A US 5856104A
Authority
US
United States
Prior art keywords
seq
nos
replaced
nucleic acid
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime
Application number
US08/813,508
Inventor
Mark Chee
Jian-Bing Fan
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Affymetrix Inc
Original Assignee
Affymetrix Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Affymetrix Inc filed Critical Affymetrix Inc
Priority to US08/813,508 priority Critical patent/US5856104A/en
Assigned to AFFYMETRIX, INC. reassignment AFFYMETRIX, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: CHEE, MARK, FAN, JIAN-BING
Priority to PCT/US1997/019665 priority patent/WO1998018967A1/en
Priority to AU51554/98A priority patent/AU5155498A/en
Assigned to AFFYMETRIX, INC. reassignment AFFYMETRIX, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: CHEE, MARK
Application granted granted Critical
Publication of US5856104A publication Critical patent/US5856104A/en
Assigned to AFFYMETRIX, INC., A DELAWARE CORPORATION reassignment AFFYMETRIX, INC., A DELAWARE CORPORATION MERGER (SEE DOCUMENT FOR DETAILS). Assignors: AFFYMETRIX, INC., A CALIFORNIA CORPORATION
Assigned to GENERAL ELECTRIC CAPITAL CORPORATION, AS AGENT reassignment GENERAL ELECTRIC CAPITAL CORPORATION, AS AGENT SECURITY AGREEMENT Assignors: AFFYMETRIX, INC.
Assigned to BANK OF AMERICA, N.A., AS ADMINISTRATIVE AGENT reassignment BANK OF AMERICA, N.A., AS ADMINISTRATIVE AGENT SECURITY INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: AFFYMETRIX, INC.
Assigned to AFFYMETRIX, INC. reassignment AFFYMETRIX, INC. RELEASE BY SECURED PARTY (SEE DOCUMENT FOR DETAILS). Assignors: GENERAL ELECTRIC CAPITAL CORPORATION, AS AGENT
Assigned to AFFYMETRIX, INC. reassignment AFFYMETRIX, INC. NOTICE OF RELEASE Assignors: BANK OF AMERICA, N.A.
Anticipated expiration legal-status Critical
Expired - Lifetime legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6827Hybridisation assays for detection of mutation or polymorphism
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers

Definitions

  • the variant form may confer an evolutionary advantage or disadvantage relative to a progenitor form or may be neutral.
  • a variant form confers a lethal disadvantage and is not transmitted to subsequent generations of the organism.
  • a variant form confers an evolutionary advantage to the species and is eventually incorporated into the DNA of many or most members of the species and effectively becomes the progenitor form.
  • both progenitor and variant form(s) survive and co-exist in a species population. The coexistence of multiple forms of a sequence gives rise to polymorphisms.
  • a restriction fragment length polymorphism means a variation in DNA sequence that alters the length of a restriction fragment as described in Botstein et al., Am. J. Hum. Genet. 32, 314-331 (1980).
  • the restriction fragment length polymorphism may create or delete a restriction site, thus changing the length of the restriction fragment.
  • RFLPs have been widely used in human and animal genetic analyses (see WO 90/13668; WO90/11369; Donis-Keller, Cell 51, 319-337 (1987); Lander et al., Genetics 121, 85-99 (1989)).
  • a heritable trait can be linked to a particular RFLP, the presence of the RFLP in an individual can be used to predict the likelihood that the animal will also exhibit the trait.
  • VNTR variable number tandem repeat
  • polymorphisms take the form of single nucleotide variations between individuals of the same species. Such polymorphisms are far more frequent than RFLPS, STRs and VNTRs. Some single nucleotide polymorphisms occur in protein-coding sequences, in which case, one of the polymorphic forms may give rise to the expression of a defective or other variant protein and, potentially, a genetic disease. Examples of genes, in which polymorphisms within coding sequences give rise to genetic disease include ⁇ -globin (sickle cell anemia) and CFTR (cystic fibrosis). Other single nucleotide polymorphisms occur in noncoding regions. Some of these polymorphisms may also result in defective protein expression (e.g., as a result of defective splicing). Other single nucleotide polymorphisms have no phenotypic effects.
  • the invention further provides allele-specific oligonucleotides that hybridizes to a sequence shown in TABLE 2 (SEQ ID NOS:1and 2), TABLE 3(SEQ ID NOS:3 and 4), TABLE 4 (SEQ ID NOS:5 and 6), TABLE 5 (SEQ ID NOS:7-15), TABLE 6 (SEQ ID NOS:16 and 17), TABLE 7 (SEQ ID NOS:18 and 19), TABLE 8 (SEQ ID NOS:20 and 21), TABLE 9 (SEQ ID NOS:22-24), TABLE 10 (SEQ ID NOS:25-27) and TABLE 11 (SEQ ID NOS:28 and 29) or its complement.
  • These oligonucleotides can be probes or primers.
  • the invention further provides a method of analyzing a nucleic acid from an individual.
  • the method determines which base is present at any one of the polymorphic sites shown in TABLE 2(SEQ ID NOS:1 and 2), TABLE 3 (SEQ ID NOS:3 and 4), TABLE 4 (SEQ ID NOS:5 and 6), TABLE 5 (SEQ ID NOS:7-15), TABLE 6 (SEQ ID NOS:16 and 17), TABLE 7 (SEQ ID NOS:18 and 19), TABLE 8 (SEQ ID NOS:20 and 21), TABLE 9 (SEQ ID NOS:22-24), TABLE 10 (SEQ ID NOS:25-27) and TABLE 11 (SEQ ID NOS:28 and 29).
  • This type of analysis can be performed on a plurality of individuals who are tested for the presence of a disease phenotype.
  • the presence or absence of disease phenotype can then be correlated with a base or set of bases present at the polymorphic sites in the individuals tested.
  • the segments are usually between 5 and 100 bases, and often between 5-10, 5-20, 10-20, 10-50, 20-50 or 20-100 bases.
  • the polymorphic site can occur within any position of the segment.
  • the segments can be from any of the allelic forms of DNA shown in TABLE2 (SEQ ID NOS:1 and 2), TABLE 3 (SEQ ID NOS:3 and 4), TABLE 4 (SEQ ID NOS:5 and 6), TABLE 5 (SEQ ID NOS:7-15), TABLE 6 (SEQ ID NOS:16 and 17), TABLE 7 (SEQ ID NOS:18 and 19), TABLE 8 (SEQ ID NOS:20 and 21), TABLE 9 (SEQ ID NOS:22-24), TABLE 10 (SEQ ID NOS:25-27) and TABLE 11 (SEQ ID NOS:28 and 29).
  • primer refers to a single-stranded oligonucleotide capable of acting as a point of initiation of template-directed DNA synthesis under appropriate conditions (i.e., in the presence of four different nucleoside triphosphates and an agent for polymerization, such as, DNA or RNA polymerase or reverse transcriptase) in an appropriate buffer and at a suitable temperature.
  • the appropriate length of a primer depends on the intended use of the primer but typically ranges from 15 to 30 nucleotides. Short primer molecules generally require cooler temperatures to form sufficiently stable hybrid complexes with the template.
  • a primer need not reflect the exact sequence of the template but must be sufficiently complementary to hybridize with a template.
  • primer site refers to the area of the target DNA to which a primer hybridizes.
  • primer pair means a set of primers including a 5' upstream primer that hybridizes with the 5' end of the DNA sequence to be amplified and a 3', downstream primer that hybridizes with the complement of the 3' end of the sequence to be amplified.
  • Linkage describes the tendency of genes, alleles, loci or genetic markers to be inherited together as a result of their location on the same chromosome, and can be measured by percent recombination between the two genes, alleles, loci or genetic markers.
  • Polymorphism refers to the occurrence of two or more genetically determined alternative sequences or alleles in a population.
  • a polymorphic marker or site is the locus at which divergence occurs. Preferred markers have at least two alleles, each occurring at frequency of greater than 1%, and more preferably greater than 10% or 20% of a selected population.
  • a polymorphic locus may be as small as one base pair.
  • Polymorphic markers include restriction fragment length polymorphisms, variable number of tandem repeats (VNTR's), hypervariable regions, minisatellites, dinucleotide repeats, trinucleotide repeats, tetranucleotide repeats, simple sequence repeats, and insertion elements such as Alu.
  • allelic form is arbitrarily designated as a the reference form and other allelic forms are designated as alternative or variant alleles.
  • allelic form occurring most frequently in a selected population is sometimes referred to as the wildtype form. Diploid organisms may be homozygous or heterozygous for allelic forms.
  • a diallelic polymorphism has two forms.
  • a triallelic polymorphism has three forms.
  • a single nucleotide polymorphism usually arises due to substitution of one nucleotide for another at the polymorphic site.
  • a transition is the replacement of one purine by another purine or one pyrimidine by another pyrimidine.
  • a transversion is the replacement of a purine by a pyrimidine or vice versa.
  • Single nucleotide polymorphisms can also arise from a deletion of a nucleotide or an insertion of a nucleotide relative to a reference allele.
  • Hybridizations are usually performed under stringent conditions, for example, at a salt concentration of no more than 1M and a temperature of at least 25° C.
  • stringent conditions for example, at a salt concentration of no more than 1M and a temperature of at least 25° C.
  • 5X SSPE 750 mM NaCl, 50 mM NaPhosphate, 5 mM EDTA, pH 7.4
  • a temperature of 25°-30° C. are suitable for allele-specific probe hybridizations.
  • An isolated nucleic acid means an object species invention) that is the predominant species present (i.e., on a molar basis it is more abundant than any other individual species in the composition).
  • an isolated nucleic acid comprises at least about 50, 80 or 90 percent (on a molar basis) of all macromolecular species present.
  • the object species is purified to essential homogeneity (contaminant species cannot be detected in the composition by conventional detection methods).
  • the human glucose-6-phosphate dehyrogenase locus encompasses more than 50,000 bp and resides on the X chromosome.
  • a complete prototypical sequence of the G6PD locus has been published. That locus has remained relatively unexplored due to the cost and difficulty of conventional sequence analysis. The published sequence shows that the G6PD locus contains at least two genes, the G6PD gene and the 2 -- 19 gene. Those genes span approximately 16,000 bp and 10,000 bp, respectively.
  • the enzyme G6PD play a fundamental role in glucose metabolism. The function of the 2-19 polypeptide product, however, has not been shown.
  • the present application provides 10 polymorphisms at 10 sequence tagged sites in the human G6PD locus.
  • Table 1 shows the base occupied at those ten sites in 10 individuals.
  • the sequences flanking each of these polymorphisms are shown in TABLE 2 (SEQ ID NOS:1 and 2), TABLE 3 (SEQ ID NOS:3 and 4), TABLE 4 (SEQ ID NOS:5 and 6), TABLE 5 (SEQ ID NOS:7-15), TABLE 6 (SEQ ID NOS:16 and 17), TABLE 7 (SEQ ID NOS:18 and 19), TABLE 8 (SEQ ID NOS:20 and 21), TABLE 9 (SEQ ID NOS:22-24), TABLE 10 (SEQ ID NOS:25-27) and TABLE 11 (SEQ ID NOS:28 and 29).
  • the polymorphic site is flanked by bold lines in the table.
  • the sequences designated M1-M10 represent novel allelic variants of this site.
  • the designation N as it appears in Tables 1-11 means the
  • Polymorphisms are detected in a target nucleic acid from an individual being analyzed.
  • genomic DNA virtually any biological sample (other than pure red blood cells) is suitable.
  • tissue samples include whole blood, semen, saliva, tears, urine, fecal material, sweat, buccal, skin and hair.
  • tissue sample For assay of cDNA or mRNA, the tissue sample must be obtained from an organ in which the target nucleic acid is expressed.
  • PCR DNA Amplification
  • PCR Protocols A Guide to Methods and Applications (eds. Innis, et al., Academic Press, San Diego, Calif., 1990); Mattila et al., Nucleic Acids Res. 19, 4967 (1991); Eckert et al., PCR Methods and Applications 1, 17 (1991); PCR (eds. McPherson et al., IRL Press, Oxford); and U.S. Pat. No. 4,683,202 (each of which is incorporated by reference for all purposes).
  • LCR ligase chain reaction
  • NASBA nucleic acid based sequence amplification
  • the latter two amplification methods involve isothermal reactions based on isothermal transcription, which produce both single stranded RNA (ssRNA) and double stranded DNA (dsDNA) as the amplification products in a ratio of about 30 or 100 to 1, respectively.
  • ssRNA single stranded RNA
  • dsDNA double stranded DNA
  • the first type of analysis is sometimes referred to as de novo characterization. This analysis compares target sequences in different individuals to identify points of variation, i.e., polymorphic sites. By analyzing a groups of individuals representing the greatest ethnic diversity among humans and greatest breed and species variety in plants and animals, patterns characteristic of the most common alleles/haplotypes of the locus can be identified, and the frequencies of such populations in the population determined. Additional allelic frequencies can be determined for subpopulations characterized by criteria such as geography, race, or gender. The de novo identification of the polymorphisms of the invention is described in the Examples section.
  • the second type of analysis is determining which form(s) of a characterized polymorphism are present in individuals under test. There are a variety of suitable procedures, which are discussed in turn.
  • Allele-specific probes for analyzing polymorphisms is described by e.g., Saiki et al., Nature 324, 163-166 (1986); Dattagupta, EP 235,726, Saiki, WO 89/11548. Allele-specific probes can be designed that hybridize to a segment of target DNA from one individual but do not hybridize to the corresponding segment from another individual due to the presence of different polymorphic forms in the respective segments from the two individuals. Hybridization conditions should be sufficiently stringent that there is a significant difference in hybridization intensity between alleles, and preferably an essentially binary response, whereby a probe hybridizes to only one of the alleles.
  • Some probes are designed to hybridize to a segment of target DNA such that the polymorphic site aligns with a central position (e.g., in a 15 mer at the 7 position; in a 16 mer, at either the 8 or 9 position) of the probe. This design of probe achieves good discrimination in hybridization between different allelic forms.
  • Allele-specific probes are often used in pairs, one member of a pair showing a perfect match to a reference form of a target sequence and the other member showing a perfect match to a variant form. Several pairs of probes can then be immobilized on the same support for simultaneous analysis of multiple polymorphisms within the same target sequence.
  • the polymorphisms can also be identified by hybridization to nucleic acid arrays, some example of which are described by WO 95/11995 (incorporated by reference in its entirety for all purposes).
  • One form of such arrays is described in the Examples section in connection with de novo identification of polymorphisms.
  • the same array or a different array can be used for analysis of characterized polymorphisms.
  • WO 95/11995 also describes subarrays that are optimized for detection of a variant forms of a precharacterized polymorphism.
  • Such a subarray contains probes designed to be complementary to a second reference sequence, which is an allelic variant of the first reference sequence.
  • the second group of probes is designed by the same principles as described in the Examples except that the probes exhibit complementarily to the second reference sequence.
  • a second group (or further groups) can be particular useful for analyzing short subsequences of the primary reference sequence in which multiple mutations are expected to occur within a short distance commensurate with the length of the probes (i.e., two or more mutations within 9 to 21 bases).
  • An allele-specific primer hybridizes to a site on target DNA overlapping a polymorphism and only primes amplification of an allelic form to which the primer exhibits perfect complementarily. See Gibbs, Nucleic Acid Res. 17, 2427-2448 (1989). This primer is used in conjunction with a second primer which hybridizes at a distal site. Amplification proceeds from the two primers leading to a detectable product signifying the particular allelic form is present. A control is usually performed with a second pair of primers, one of which shows a single base mismatch at the polymorphic site and the other of which exhibits perfect complementarily to a distal site. The single-base mismatch prevents amplification and no detectable product is formed.
  • the method works best when the mismatch is included in the 3'-most position of the oligonucleotide aligned with the polymorphism because this position is most destabilizing to elongation from the primer. See, e.g., WO 93/22456.
  • the direct analysis of the sequence of polymorphisms of the present invention can be accomplished using either the dideoxy chain termination method or the Maxam Gilbert method (see Sambrook et al., Molecular Cloning, A Laboratory Manual (2nd Ed., CSHP, New York 1989); Zyskind et al., Recombinant DNA Laboratory Manual, (Acad. Press, 1988)).
  • Amplification products generated using the polymerase chain reaction can be analyzed by the use of denaturing gradient gel electrophoresis. Different alleles can be identified based on the different sequence-dependent melting properties and electrophoretic migration of DNA in solution. Erlich, ed., PCR Technology, Principles and Applications for DNA Amplification, (W.H. Freeman and Co, New York, 1992), Chapter 7.
  • Alleles of target sequences can be differentiated using single-strand conformation polymorphism analysis, which identifies base differences by alteration in electrophoretic migration of single stranded PCR products, as described in Orita et al., Proc. Nat. Acad. Sci. 86, 2766-2770 (1989).
  • Amplified PCR products can be generated as described above, and heated or otherwise denatured, to form single stranded amplification products.
  • Single-stranded nucleic acids may refold or form secondary structures which are partially dependent on the base sequence.
  • the different electrophoretic mobilities of single-stranded amplification products can be related to base-sequence difference between alleles of target sequences.
  • this information can be used in a number of methods.
  • polymorphisms of the invention are often used in conjunction with polymorphisms in distal genes.
  • Preferred polymorphisms for use in forensics are diallelic because the population frequencies of two polymorphic forms can usually be determined with greater accuracy than those of multiple polymorphic forms at multi-allelic loci.
  • the capacity to identify a distinguishing or unique set of forensic markers in an individual is useful for forensic analysis. For example, one can determine whether a blood sample from a suspect matches a blood or other tissue sample from a crime scene by determining whether the set of polymorphic forms occupying selected polymorphic sites is the same in the suspect and the sample. If the set of polymorphic markers does not match between a suspect and a sample, it can be concluded (barring experimental error) that the suspect was not the source of the sample. If the set of markers does match, one can conclude that the DNA from the suspect is consistent with that found at the crime scene. If frequencies of the polymorphic forms at the loci tested have been determined (e.g., by analysis of a suitable population of individuals), one can perform a statistical analysis to determine the probability that a match of suspect and crime scene sample would occur by chance.
  • p(ID) is the probability that two random individuals have the same polymorphic or allelic form at a given polymorphic site. In diallelic loci, four genotypes are possible: AA, AB, BA, and BB. If alleles A and B occur in a haploid genome of the organism with frequencies x and y, the probability of each genotype in a diploid organism are (see WO 95/12607):
  • the probability of identity p(ID) for a 3-allele system where the alleles have the frequencies in the population of x, y and z, respectively, is equal to the sum of the squares of the genotype frequencies:
  • the cumulative probability of identity (cum p(ID)) for each of multiple unlinked loci is determined by multiplying the probabilities provided by each locus.
  • the cumulative probability of non-identity for random individuals becomes very high (e.g., one billion to one). Such probabilities can be taken into account together with other evidence in determining the guilt or innocence of the suspect.
  • the object of paternity testing is usually to determine whether a male is the father of a child. In most cases, the mother of the child is known and thus, the mother's contribution to the child's genotype can be traced. Paternity testing investigates whether the part of the child's genotype not attributable to the mother is consistent with that of the putative father. Paternity testing can be performed by analyzing sets of polymorphisms in the putative father and the child.
  • the set of polymorphisms in the child attributable to the father does not match the putative father, it can be concluded, barring experimental error, that the putative father is not the real father. If the set of polymorphisms in the child attributable to the father does match the set of polymorphisms of the putative father, a statistical calculation can be performed to determine the probability of coincidental match.
  • x and y are the population frequencies of alleles A and B of a diallelic polymorphic site.
  • the cumulative probability of exclusion of a random male is very high. This probability can be taken into account in assessing the liability of a putative father whose polymorphic marker set matches the child's polymorphic marker set attributable to his/her father.
  • the polymorphisms of the invention may contribute to the phenotype of an organism in different ways. Some polymorphisms occur within a protein coding sequence and contribute to phenotype by affecting protein structure. The effect may be neutral, beneficial or detrimental, or both beneficial and detrimental, depending on the circumstances. For example, a heterozygous sickle cell mutation confers resistance to malaria, but a homozygous sickle cell mutation is usually lethal. Other polymorphisms occur in noncoding regions but may exert phenotypic effects indirectly via influence on replication, transcription, and translation. A single polymorphism may affect more than one phenotypic trait. Likewise, a single phenotypic trait may be affected by polymorphisms in different genes. Further, some polymorphisms predispose an individual to a distinct mutation that is causally related to a certain phenotype.
  • Phenotypic traits include diseases that have known but hitherto unmapped genetic components. Phenotypic traits also include symptoms of, or susceptibility to, multifactorial diseases of which a component is or may be genetic, such as autoimmune diseases, inflammation, cancer, diseases of the nervous system, and infection by pathogenic microorganisms. Some examples of autoimmune diseases include rheumatoid arthritis, multiple sclerosis, diabetes (insulin-dependent and non-independent), systemic lupus erythematosus and Graves disease. Some examples of cancers include cancers of the bladder, brain, breast, colon, esophagus, kidney, leukemia, liver, lung, oral cavity, ovary, pancreas, prostate, skin, stomach and uterus. Phenotypic traits also include characteristics such as longevity, appearance (e.g., baldness, obesity), strength, speed, endurance, fertility, and susceptibility or receptivity to particular drugs or therapeutic treatments.
  • characteristics such as longevity, appearance (e.g.,
  • Correlation is performed for a population of individuals who have been tested for the presence or absence of a phenotypic trait of interest and for polymorphic markers sets.
  • a set of polymorphisms i.e. a polymorphic set
  • the alleles of each polymorphism of the set are then reviewed to determine whether the presence or absence of a particular allele is associated with the trait of interest.
  • Correlation can be performed by standard statistical methods such as a ⁇ -squared test and statistically significant correlations between polymorphic form(s) and phenotypic characteristics are noted.
  • allele A1 at polymorphism A correlates with heart disease.
  • allele B1 at polymorphism B correlates with increased milk production of a farm animal.
  • Such correlations can be exploited in several ways.
  • detection of the polymorphic form set in a human or animal patient may justify immediate administration of treatment, or at least the institution of regular monitoring of the patient.
  • Detection of a polymorphic form correlated with serious disease in a couple contemplating a family may also be valuable to the couple in their reproductive decisions.
  • the female partner might elect to undergo in vitro fertilization to avoid the possibility of transmitting such a polymorphism from her husband to her offspring.
  • immediate therapeutic intervention or monitoring may not be justified.
  • the patient can be motivated to begin simple life-style changes (e.g., diet, exercise) that can be accomplished at little cost to the patient but confer potential benefits in reducing the risk of conditions to which the patient may have increased susceptibility by virtue of variant alleles.
  • Identification of a polymorphic set in a patient correlated with enhanced receptiveness to one of several treatment regimes for a disease indicates that this treatment regime should be followed.
  • Y ijknp is the milk, fat, fat percentage, SNF, SNF percentage, energy concentration, or lactation energy record
  • is an overall mean
  • YS i is the effect common to all cows calving in year-season
  • X k is the effect common to cows in either the high or average selection line
  • ⁇ 1 to ⁇ 17 are the binomial regressions of production record on mtDNA D-loop sequence polymorphisms
  • PE n is permanent environmental effect common to all records of cow n
  • a n is effect of animal n and is composed of the additive genetic contribution of sire and dam breeding values and a Mendelian sampling effect
  • e p is a random residual. It was found that eleven of seventeen polymorphisms tested influenced at least one production trait. Bovines having the best polymorphic forms for milk production at these eleven loci are used as parents for breeding the next generation of the herd.
  • the previous section concerns identifying correlations between phenotypic traits and polymorphisms that directly or indirectly contribute to those traits.
  • the present section describes identification of a physical linkage between a genetic locus associated with a trait of interest and polymorphic markers that are not associated with the trait, but are in physical proximity with the genetic locus responsible for the trait and co-segregate with it.
  • Such analysis is useful for mapping a genetic locus associated with a phenotypic trait to a chromosomal position, and thereby cloning gene(s) responsible for the trait. See Lander et al., Proc. Natl. Acad. Sci. (USA) 83, 7353-7357 (1986); Lander et al., Proc. Natl. Acad.
  • Linkage studies are typically performed on members of a family. Available members of the family are characterized for the presence or absence of a phenotypic trait and for a set of polymorphic markers. The distribution of polymorphic markers in an informative meiosis is then analyzed to determine which polymorphic markers co-segregate with a phenotypic trait. See, e.g., Kerem et al., Science 245, 1073-1080 (1989); Monaco et al., Nature 316, 842 (1985); Yamoka et al., Neurology 40, 222-226 (1990); Rossiter et al., FASEB Journal 5, 21-27 (1991).
  • Linkage is analyzed by calculation of LOD (log of the odds) values.
  • a lod value is the relative likelihood of obtaining observed segregation data for a marker and a genetic locus when the two are located at a recombination fraction ⁇ , versus the situation in which the two are not linked, and thus segregating independently (Thompson & Thompson, Genetics in Medicine (5th ed, W.B. Saunders Company, Philadelphia, 1991); Strachan, "Mapping the human genome” in The Human Genome (BIOS Scientific Publishers Ltd, Oxford), Chapter 4).
  • the likelihood at a given value of ⁇ is: probability of data if loci linked at ⁇ to probability of data if loci unlinked.
  • the computed likelihoods are usually expressed as the log 10 of this ratio (i.e., a lod score). For example, a lod score of 3 indicates 1000:1 odds against an apparent observed linkage being a coincidence.
  • the use of logarithms allows data collected from different families to be combined by simple addition. Computer programs are available for the calculation of lod scores for differing values of ⁇ (e.g., LIPED, MLINK (Lathrop, Proc. Nat. Acad. Sci. (USA) 81, 3443-3446 (1984)).
  • a recombination fraction may be determined from mathematical tables. See Smith et al., Mathematical tables for research workers in human genetics (Churchill, London, 1961); Smith, Ann. Hum. Genet. 32, 127-150 (1968). The value of ⁇ at which the lod score is the highest is considered to be the best estimate of the recombination fraction.
  • Positive lod score values suggest that the two loci are linked, whereas negative values suggest that linkage is less likely (at that value of ⁇ ) than the possibility that the two loci are unlinked.
  • a combined lod score of +3 or greater is considered definitive evidence that two loci are linked.
  • a negative lod score of -2 or less is taken as definitive evidence against linkage of the two loci being compared.
  • Negative linkage data are useful in excluding a chromosome or a segment thereof from consideration. The search focuses on the remaining non-excluded chromosomal locations.
  • the invention further provides variant forms of nucleic acids and corresponding proteins.
  • the nucleic acids comprise at least ten contiguous bases of one of the sequences described in TABLE 2 (SEQ ID NOS:1 and 2), TABLE 3 (SEQ ID NOS:3 and 4), TABLE 4 (SEQ ID NOS:5 and 6), TABLE 5 (SEQ ID NOS:7-15), TABLE 6 (SEQ ID NOS:16 and 17), TABLE 7 (SEQ ID NOS:18 and 19), TABLE 8 (SEQ ID NOS:20 and 21), TABLE 9 (SEQ ID NOS:22-24), TABLE 10 (SEQ ID NOS:25-27) and TABLE 11 (SEQ ID NOS:28 and 29). designated M1-M10.
  • variant proteins have the prototypical amino acid sequences of encoded by nucleic acid sequence shown in Tables 2-11, designated M1-M10 (read so as to be in-frame with the full-length coding sequence of which it is a component).
  • Variant genes can be expressed in an expression vector in which a variant gene is operably linked to a native or other promoter.
  • the promoter is a eukaryotic promoter for expression in a mammalian cell.
  • the transcription regulation sequences typically include a heterologous promoter and optionally an enhancer which is recognized by the host.
  • the selection of an appropriate promoter for example trp, lac, phage promoters, glycolytic enzyme promoters and tRNA promoters, depends on the host selected.
  • Commercially available expression vectors can be used. Vectors can include host-recognized replication systems, amplifiable genes, selectable markers, host sequences useful for insertion into the host genome, and the like.
  • the means of introducing the expression construct into a host cell varies depending upon the particular construction and the target host. Suitable means include fusion, conjugation, transfection, transduction, electroporation or injection, as described in Sambrook, supra.
  • a wide variety of host cells can be employed for expression of the variant gene, both prokaryotic and eukaryotic. Suitable host cells include bacteria such as E. coli, yeast, filamentous fungi, insect cells, mammalian cells, typically immortalized, e.g., mouse, CHO, human and monkey cell lines and derivatives thereof. Preferred host cells are able to process the variant gene product to produce an appropriate mature polypeptide. Processing includes glycosylation, ubiquitination, disulfide bond formation, general post-translational modification, and the like.
  • the protein may be isolated by conventional means of protein biochemistry and purification to obtain a substantially pure product, i.e., 80, 95 or 99% free of cell component contaminants, as described in Jacoby, Methods in Enzymology Volume 104, Academic Press, New York (1984); Scopes, Protein Purification, Principles and Practice, 2nd Edition, Springer-Verlag, New York (1987); and Deutscher (ed), Guide to Protein Purification, Methods in Enzymology, Vol. 182 (1990). If the protein is secreted, it can be isolated from the supernatant in which the host cell is grown. If not secreted, the protein can be isolated from a lysate of the host cells.
  • the present invention includes biologically active fragments of the polypeptides, or analogs thereof, including organic molecules which simulate the interactions of the peptides.
  • biologically active fragments include any portion of the full-length polypeptide which confers a biological function on the variant gene product, including ligand binding, and antibody binding.
  • Ligand binding includes binding by nucleic acids, proteins or polypeptides, small biologically active molecules, or large cellular structures.
  • Antibodies that specifically bind to variant gene products but not to corresponding prototypical gene products are also provided.
  • Antibodies can be made by injecting mice or other animals with the variant gene product or synthetic peptide fragments thereof. Monoclonal antibodies are screened as are described, for example, in Harlow & Lane, Antibodies, A Laboratory Manual, Cold Spring Harbor Press, New York (1988); Goding, Monoclonal antibodies, Principles and Practice (2d ed.) Academic Press, New York (1986). Monoclonal antibodies are tested for specific immunoreactivity with a variant gene product and lack of immunoreactivity to the corresponding prototypical gene product. These antibodies are useful in diagnostic assays for detection of the variant form, or as an active ingredient in a pharmaceutical composition.
  • kits comprising at least one allele-specific oligonucleotide as described above.
  • the kits contain one or more pairs of allele-specific oligonucleotides hybridizing to different forms of a polymorphism.
  • the allele-specific oligonucleotides are provided immobilized to a substrate.
  • the same substrate can comprise allele-specific oligonucleotide probes for detecting at least 10, 100 or all of the polymorphisms shown in Tables 2-11.
  • kits include, for example, restriction enzymes, reverse-transcriptase or polymerase, the substrate nucleoside triphosphates, means used to label (for example, an avidinenzyme conjugate and enzyme substrate and chromogen if the label is biotin), and the appropriate buffers for reverse transcription, PCR, or hybridization reactions.
  • the kit also contains instructions for carrying out the methods.
  • Tiling arrays are described in PCT/US94/12305 (incorporated by reference in its entirety for all purposes). Tiling generally means the synthesis of a defined set of oligonucleotide probes that is made up of a sequence complementary to the sequence to be analyzed (the "target sequence"), as well as preselected variations of that sequence. The variations usually include substitution at one or more base positions with one or more nucleotides. Tiling strategies are discussed in WO 95/11995 (incorporated by reference in its entirety for all purposes). With a tiled array containing 4L probes one can query every position in a nucleotide containing L number of bases.
  • a 4L tiled array for example, contains L number of sets of 4 probes, i.e. 4L probes.
  • Each set of 4 probes contains the perfect complement to a portion of the target sequence with a single substitution for each nucleotide at the same position in the probe. See also Chee, M., et. al., Science, October, 1996.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention provides nucleic acid segments of the glucose-6 phosphate dehydrogenase locus of the human genome including polymorphic sites. Allele-specific primers and probes hybridizing to regions flanking these sites are also provided. The nucleic acids, primers and probes are used in applications such as forensics, paternity testing, medicine and genetic analysis.

Description

CROSS-REFERENCE TO RELATED APPLICATION
The present application claims priority from provisional application 60/029,374, filed Oct. 28, 1996, which is incorporated by reference in its entirety for all purposes.
BACKGROUND OF THE INVENTION
The genomes of all organisms undergo spontaneous mutation in the course of their continuing evolution generating variant forms of progenitor sequences (Gusella, Ann. Rev. Biochem. 55, 831-854 (1986)). The variant form may confer an evolutionary advantage or disadvantage relative to a progenitor form or may be neutral. In some instances, a variant form confers a lethal disadvantage and is not transmitted to subsequent generations of the organism. In other instances, a variant form confers an evolutionary advantage to the species and is eventually incorporated into the DNA of many or most members of the species and effectively becomes the progenitor form. In many instances, both progenitor and variant form(s) survive and co-exist in a species population. The coexistence of multiple forms of a sequence gives rise to polymorphisms.
Several different types of polymorphism have been reported. A restriction fragment length polymorphism (RFLP) means a variation in DNA sequence that alters the length of a restriction fragment as described in Botstein et al., Am. J. Hum. Genet. 32, 314-331 (1980). The restriction fragment length polymorphism may create or delete a restriction site, thus changing the length of the restriction fragment. RFLPs have been widely used in human and animal genetic analyses (see WO 90/13668; WO90/11369; Donis-Keller, Cell 51, 319-337 (1987); Lander et al., Genetics 121, 85-99 (1989)). When a heritable trait can be linked to a particular RFLP, the presence of the RFLP in an individual can be used to predict the likelihood that the animal will also exhibit the trait.
Other polymorphisms take the form of short tandem repeats (STRs) that include tandem di-, tri- and tetranucleotide repeated motifs. These tandem repeats are also referred to as variable number tandem repeat (VNTR) polymorphisms. VNTRs have been used in identity and paternity analysis (U.S. Pat. No. 5,075,217; Armour et al., FEBS Lett. 307, 113-115 (1992); Horn et al., WO 91/14003; Jeffreys, EP 370,719), and in a large number of genetic mapping studies.
Other polymorphisms take the form of single nucleotide variations between individuals of the same species. Such polymorphisms are far more frequent than RFLPS, STRs and VNTRs. Some single nucleotide polymorphisms occur in protein-coding sequences, in which case, one of the polymorphic forms may give rise to the expression of a defective or other variant protein and, potentially, a genetic disease. Examples of genes, in which polymorphisms within coding sequences give rise to genetic disease include β-globin (sickle cell anemia) and CFTR (cystic fibrosis). Other single nucleotide polymorphisms occur in noncoding regions. Some of these polymorphisms may also result in defective protein expression (e.g., as a result of defective splicing). Other single nucleotide polymorphisms have no phenotypic effects.
Single nucleotide polymorphisms can be used in the same manner as RFLPs, and VNTRs but offer several advantages. Single nucleotide polymorphisms occur with greater frequency and are spaced more uniformly throughout the genome than other forms of polymorphism. The greater frequency and uniformity of single nucleotide polymorphisms means that there is a greater probability that such a polymorphism will be found in close proximity to a genetic locus of interest than would be the case for other polymorphisms. Also, the different forms of characterized single nucleotide polymorphisms are often easier to distinguish that other types of polymorphism (e.g., by use of assays employing allele-specific hybridization probes or primers).
Despite the increased amount of nucleotide sequence data being generated in recent years, only a minute proportion of the total repository of polymorphisms in humans and other organisms has so far been identified. The paucity of polymorphisms hitherto identified is due to the large amount of work required for their detection by conventional methods. For example, a conventional approach to identifying polymorphisms might be to sequence the same stretch of oligonucleotides in a population of individuals by didoxy sequencing. In this type of approach, the amount of work increases in proportion to both the length of sequence and the number of individuals in a population and becomes impractical for large stretches of DNA or large numbers of persons.
SUMMARY OF THE INVENTION
The invention provides nucleic acid segments of between 10 and 100 bases containing at least 10, 15 or 20 contiguous amino acids from any of the sequences shown in any of TABLE 2 (SEQ ID NOS:1 and 2), TABLE 3 (SEQ ID NOS:3 and 4), TABLE 4 (SEQ ID NOS:5 and 6), TABLE 5 (SEQ ID NOS:7-15), TABLE 6 (SEQ ID NOS:16 and 17), TABLE 7 (SEQ ID NOS:18 and 19), TABLE 8 (SEQ ID NOS:20 and 21), TABLE 9 (SEQ ID NOS:22-24), TABLE 10 (SEQ ID NOS:25-27) and TABLE 11 (SEQ ID NOS:28 and 29) including a polymorphic site. Complements of these segments are also included. The segments can be DNA or RNA, and can be double- or single-stranded. Some segments are 10-20 or 10-50 bases long. Preferred segments include a diallelic polymorphic 25 site.
The invention further provides allele-specific oligonucleotides that hybridizes to a sequence shown in TABLE 2 (SEQ ID NOS:1and 2), TABLE 3(SEQ ID NOS:3 and 4), TABLE 4 (SEQ ID NOS:5 and 6), TABLE 5 (SEQ ID NOS:7-15), TABLE 6 (SEQ ID NOS:16 and 17), TABLE 7 (SEQ ID NOS:18 and 19), TABLE 8 (SEQ ID NOS:20 and 21), TABLE 9 (SEQ ID NOS:22-24), TABLE 10 (SEQ ID NOS:25-27) and TABLE 11 (SEQ ID NOS:28 and 29) or its complement. These oligonucleotides can be probes or primers.
The invention further provides a method of analyzing a nucleic acid from an individual. The method determines which base is present at any one of the polymorphic sites shown in TABLE 2(SEQ ID NOS:1 and 2), TABLE 3 (SEQ ID NOS:3 and 4), TABLE 4 (SEQ ID NOS:5 and 6), TABLE 5 (SEQ ID NOS:7-15), TABLE 6 (SEQ ID NOS:16 and 17), TABLE 7 (SEQ ID NOS:18 and 19), TABLE 8 (SEQ ID NOS:20 and 21), TABLE 9 (SEQ ID NOS:22-24), TABLE 10 (SEQ ID NOS:25-27) and TABLE 11 (SEQ ID NOS:28 and 29). Optionally, a set of bases occupying a set of the polymorphic sites shown in TABLE 2 (SEQ ID NOS:1 and 2), TABLE 3 (SEQ ID NOS:3 and 4), TABLE 4 (SEQ ID NOS:5 and 6), TABLE 5 (SEQ ID NOS:7-15), TABLE 6 (SEQ ID NOS:16 and 17), TABLE 7 (SEQ ID NOS:18 and 19), TABLE 8 (SEQ ID NOS:20 and 21), TABLE 9 (SEQ ID NOS:22-24), TABLE 10 (SEQ ID NOS:25-27) and TABLE 11 (SEQ ID NOS:28 and 29). is determined. This type of analysis can be performed on a plurality of individuals who are tested for the presence of a disease phenotype. The presence or absence of disease phenotype can then be correlated with a base or set of bases present at the polymorphic sites in the individuals tested.
DEFINITIONS
An oligonucleotide can be DNA or RNA, and single- or double-stranded. Oligonucleotides can be naturally occurring or synthetic, but are typically prepared by synthetic means. Preferred oligonucleotides of the invention include segments of DNA, or their complements including any one of the polymorphic sites shown in TABLE 2 (SEQ ID NOS:1 and 2), TABLE 3 (SEQ ID NOS:3 and 4), TABLE 4 (SEQ ID NOS:5 and 6), TABLE 5 (SEQ ID NOS:7-15), TABLE 6 (SEQ ID NOS:16 and 17), TABLE 7 (SEQ ID NOS:18 and 19), TABLE 8 (SEQ ID NOS:20 and 21), TABLE 9 (SEQ ID NOS:22-24), TABLE 10 (SEQ ID NOS:25-27) and TABLE 11 (SEQ ID NOS:28 and 29). The segments are usually between 5 and 100 bases, and often between 5-10, 5-20, 10-20, 10-50, 20-50 or 20-100 bases. The polymorphic site can occur within any position of the segment. The segments can be from any of the allelic forms of DNA shown in TABLE2 (SEQ ID NOS:1 and 2), TABLE 3 (SEQ ID NOS:3 and 4), TABLE 4 (SEQ ID NOS:5 and 6), TABLE 5 (SEQ ID NOS:7-15), TABLE 6 (SEQ ID NOS:16 and 17), TABLE 7 (SEQ ID NOS:18 and 19), TABLE 8 (SEQ ID NOS:20 and 21), TABLE 9 (SEQ ID NOS:22-24), TABLE 10 (SEQ ID NOS:25-27) and TABLE 11 (SEQ ID NOS:28 and 29).
Hybridization probes are oligonucleotides capable of binding in a base-specific manner to a complementary strand of nucleic acid. Such probes include peptide nucleic acids, as described in Nielsen et al., Science 254, 1497-1500 (1991).
The term primer refers to a single-stranded oligonucleotide capable of acting as a point of initiation of template-directed DNA synthesis under appropriate conditions (i.e., in the presence of four different nucleoside triphosphates and an agent for polymerization, such as, DNA or RNA polymerase or reverse transcriptase) in an appropriate buffer and at a suitable temperature. The appropriate length of a primer depends on the intended use of the primer but typically ranges from 15 to 30 nucleotides. Short primer molecules generally require cooler temperatures to form sufficiently stable hybrid complexes with the template. A primer need not reflect the exact sequence of the template but must be sufficiently complementary to hybridize with a template. The term primer site refers to the area of the target DNA to which a primer hybridizes. The term primer pair means a set of primers including a 5' upstream primer that hybridizes with the 5' end of the DNA sequence to be amplified and a 3', downstream primer that hybridizes with the complement of the 3' end of the sequence to be amplified.
Linkage describes the tendency of genes, alleles, loci or genetic markers to be inherited together as a result of their location on the same chromosome, and can be measured by percent recombination between the two genes, alleles, loci or genetic markers.
Polymorphism refers to the occurrence of two or more genetically determined alternative sequences or alleles in a population. A polymorphic marker or site is the locus at which divergence occurs. Preferred markers have at least two alleles, each occurring at frequency of greater than 1%, and more preferably greater than 10% or 20% of a selected population. A polymorphic locus may be as small as one base pair. Polymorphic markers include restriction fragment length polymorphisms, variable number of tandem repeats (VNTR's), hypervariable regions, minisatellites, dinucleotide repeats, trinucleotide repeats, tetranucleotide repeats, simple sequence repeats, and insertion elements such as Alu. The first identified allelic form is arbitrarily designated as a the reference form and other allelic forms are designated as alternative or variant alleles. The allelic form occurring most frequently in a selected population is sometimes referred to as the wildtype form. Diploid organisms may be homozygous or heterozygous for allelic forms. A diallelic polymorphism has two forms. A triallelic polymorphism has three forms.
A single nucleotide polymorphism occurs at a polymorphic site occupied by a single nucleotide, which is the site of variation between allelic sequences. The site is usually preceded by and followed by highly conserved sequences of the allele (e.g., sequences that vary in less than 1/100 or 1/1000 members of the populations).
A single nucleotide polymorphism usually arises due to substitution of one nucleotide for another at the polymorphic site. A transition is the replacement of one purine by another purine or one pyrimidine by another pyrimidine. A transversion is the replacement of a purine by a pyrimidine or vice versa. Single nucleotide polymorphisms can also arise from a deletion of a nucleotide or an insertion of a nucleotide relative to a reference allele.
Hybridizations are usually performed under stringent conditions, for example, at a salt concentration of no more than 1M and a temperature of at least 25° C. For example, conditions of 5X SSPE (750 mM NaCl, 50 mM NaPhosphate, 5 mM EDTA, pH 7.4) and a temperature of 25°-30° C. are suitable for allele-specific probe hybridizations.
An isolated nucleic acid means an object species invention) that is the predominant species present (i.e., on a molar basis it is more abundant than any other individual species in the composition). Preferably, an isolated nucleic acid comprises at least about 50, 80 or 90 percent (on a molar basis) of all macromolecular species present. Most preferably, the object species is purified to essential homogeneity (contaminant species cannot be detected in the composition by conventional detection methods).
DESCRIPTION OF THE PRESENT INVENTION
I. Novel Polymorphisms of the Invention
The human glucose-6-phosphate dehyrogenase locus (G6PD) encompasses more than 50,000 bp and resides on the X chromosome. A complete prototypical sequence of the G6PD locus has been published. That locus has remained relatively unexplored due to the cost and difficulty of conventional sequence analysis. The published sequence shows that the G6PD locus contains at least two genes, the G6PD gene and the 2-- 19 gene. Those genes span approximately 16,000 bp and 10,000 bp, respectively. The enzyme G6PD play a fundamental role in glucose metabolism. The function of the 2-19 polypeptide product, however, has not been shown.
The present application provides 10 polymorphisms at 10 sequence tagged sites in the human G6PD locus. Table 1 shows the base occupied at those ten sites in 10 individuals. The sequences flanking each of these polymorphisms are shown in TABLE 2 (SEQ ID NOS:1 and 2), TABLE 3 (SEQ ID NOS:3 and 4), TABLE 4 (SEQ ID NOS:5 and 6), TABLE 5 (SEQ ID NOS:7-15), TABLE 6 (SEQ ID NOS:16 and 17), TABLE 7 (SEQ ID NOS:18 and 19), TABLE 8 (SEQ ID NOS:20 and 21), TABLE 9 (SEQ ID NOS:22-24), TABLE 10 (SEQ ID NOS:25-27) and TABLE 11 (SEQ ID NOS:28 and 29). The polymorphic site is flanked by bold lines in the table. The sequences designated M1-M10 represent novel allelic variants of this site. The designation N as it appears in Tables 1-11 means the identity of a base was not determined.
II. Analysis of Polymorphisms
A. Preparation of Samples
Polymorphisms are detected in a target nucleic acid from an individual being analyzed. For assay of genomic DNA, virtually any biological sample (other than pure red blood cells) is suitable. For example, convenient tissue samples include whole blood, semen, saliva, tears, urine, fecal material, sweat, buccal, skin and hair. For assay of cDNA or mRNA, the tissue sample must be obtained from an organ in which the target nucleic acid is expressed.
Many of the methods described below require amplification of DNA from target samples. This can be accomplished by e.g., PCR. See generally PCR Technology: Principles and Applications for DNA Amplification (ed. H. A. Erlich, Freeman Press, N.Y., N.Y., 1992); PCR Protocols: A Guide to Methods and Applications (eds. Innis, et al., Academic Press, San Diego, Calif., 1990); Mattila et al., Nucleic Acids Res. 19, 4967 (1991); Eckert et al., PCR Methods and Applications 1, 17 (1991); PCR (eds. McPherson et al., IRL Press, Oxford); and U.S. Pat. No. 4,683,202 (each of which is incorporated by reference for all purposes).
Other suitable amplification methods include the ligase chain reaction (LCR) (see Wu and Wallace, Genomics 4, 560 (1989), Landegren et al., Science 241, 1077 (1988), transcription amplification (Kwoh et al., Proc. Natl. Acad. Sci. USA 86, 1173 (1989)), and self-sustained sequence replication (Guatelli et al., Proc. Nat. Acad. Sci. USA, 87, 1874 (1990)) and nucleic acid based sequence amplification (NASBA). The latter two amplification methods involve isothermal reactions based on isothermal transcription, which produce both single stranded RNA (ssRNA) and double stranded DNA (dsDNA) as the amplification products in a ratio of about 30 or 100 to 1, respectively.
B. Detection of Polymorphisms in Target DNA
There are two distinct types of analysis depending whether a polymorphism in question has already been characterized. The first type of analysis is sometimes referred to as de novo characterization. This analysis compares target sequences in different individuals to identify points of variation, i.e., polymorphic sites. By analyzing a groups of individuals representing the greatest ethnic diversity among humans and greatest breed and species variety in plants and animals, patterns characteristic of the most common alleles/haplotypes of the locus can be identified, and the frequencies of such populations in the population determined. Additional allelic frequencies can be determined for subpopulations characterized by criteria such as geography, race, or gender. The de novo identification of the polymorphisms of the invention is described in the Examples section. The second type of analysis is determining which form(s) of a characterized polymorphism are present in individuals under test. There are a variety of suitable procedures, which are discussed in turn.
1. Allele-Specific Probes
The design and use of allele-specific probes for analyzing polymorphisms is described by e.g., Saiki et al., Nature 324, 163-166 (1986); Dattagupta, EP 235,726, Saiki, WO 89/11548. Allele-specific probes can be designed that hybridize to a segment of target DNA from one individual but do not hybridize to the corresponding segment from another individual due to the presence of different polymorphic forms in the respective segments from the two individuals. Hybridization conditions should be sufficiently stringent that there is a significant difference in hybridization intensity between alleles, and preferably an essentially binary response, whereby a probe hybridizes to only one of the alleles. Some probes are designed to hybridize to a segment of target DNA such that the polymorphic site aligns with a central position (e.g., in a 15 mer at the 7 position; in a 16 mer, at either the 8 or 9 position) of the probe. This design of probe achieves good discrimination in hybridization between different allelic forms.
Allele-specific probes are often used in pairs, one member of a pair showing a perfect match to a reference form of a target sequence and the other member showing a perfect match to a variant form. Several pairs of probes can then be immobilized on the same support for simultaneous analysis of multiple polymorphisms within the same target sequence.
2. Tiling Arrays
The polymorphisms can also be identified by hybridization to nucleic acid arrays, some example of which are described by WO 95/11995 (incorporated by reference in its entirety for all purposes). One form of such arrays is described in the Examples section in connection with de novo identification of polymorphisms. The same array or a different array can be used for analysis of characterized polymorphisms. WO 95/11995 also describes subarrays that are optimized for detection of a variant forms of a precharacterized polymorphism. Such a subarray contains probes designed to be complementary to a second reference sequence, which is an allelic variant of the first reference sequence. The second group of probes is designed by the same principles as described in the Examples except that the probes exhibit complementarily to the second reference sequence. The inclusion of a second group (or further groups) can be particular useful for analyzing short subsequences of the primary reference sequence in which multiple mutations are expected to occur within a short distance commensurate with the length of the probes (i.e., two or more mutations within 9 to 21 bases).
3. Allele-Specific Primers
An allele-specific primer hybridizes to a site on target DNA overlapping a polymorphism and only primes amplification of an allelic form to which the primer exhibits perfect complementarily. See Gibbs, Nucleic Acid Res. 17, 2427-2448 (1989). This primer is used in conjunction with a second primer which hybridizes at a distal site. Amplification proceeds from the two primers leading to a detectable product signifying the particular allelic form is present. A control is usually performed with a second pair of primers, one of which shows a single base mismatch at the polymorphic site and the other of which exhibits perfect complementarily to a distal site. The single-base mismatch prevents amplification and no detectable product is formed. The method works best when the mismatch is included in the 3'-most position of the oligonucleotide aligned with the polymorphism because this position is most destabilizing to elongation from the primer. See, e.g., WO 93/22456.
4. Direct-Sequencing
The direct analysis of the sequence of polymorphisms of the present invention can be accomplished using either the dideoxy chain termination method or the Maxam Gilbert method (see Sambrook et al., Molecular Cloning, A Laboratory Manual (2nd Ed., CSHP, New York 1989); Zyskind et al., Recombinant DNA Laboratory Manual, (Acad. Press, 1988)).
5. Denaturing Gradient Gel Electrophoresis
Amplification products generated using the polymerase chain reaction can be analyzed by the use of denaturing gradient gel electrophoresis. Different alleles can be identified based on the different sequence-dependent melting properties and electrophoretic migration of DNA in solution. Erlich, ed., PCR Technology, Principles and Applications for DNA Amplification, (W.H. Freeman and Co, New York, 1992), Chapter 7.
6. Single-Strand Conformation Polymorphism Analysis
Alleles of target sequences can be differentiated using single-strand conformation polymorphism analysis, which identifies base differences by alteration in electrophoretic migration of single stranded PCR products, as described in Orita et al., Proc. Nat. Acad. Sci. 86, 2766-2770 (1989). Amplified PCR products can be generated as described above, and heated or otherwise denatured, to form single stranded amplification products. Single-stranded nucleic acids may refold or form secondary structures which are partially dependent on the base sequence. The different electrophoretic mobilities of single-stranded amplification products can be related to base-sequence difference between alleles of target sequences.
III. Methods of Use
After determining polymorphic form(s) present in an individual at one or more polymorphic sites, this information can be used in a number of methods.
A. Forensics
Determination of which polymorphic forms occupy a set of polymorphic sites in an individual identifies a set of polymorphic forms that distinguishes the individual. See generally National Research Council, The Evaluation of Forensic DNA Evidence (Eds. Pollard et al., National Academy Press, DC, 1996). Since the polymorphic sites are within a 50,000 bp region in the human genome, the probability of recombination between these polymorphic sites is low. That low probability means the haplotype (the set of all 10 polymorphic sites) set forth in this application should be inherited without change for at least several generations. The more sites that are analyzed the lower the probability that the set of polymorphic forms in one individual is the same as that in an unrelated individual. Preferably, if multiple sites are analyzed, the sites are unlinked. Thus, polymorphisms of the invention are often used in conjunction with polymorphisms in distal genes. Preferred polymorphisms for use in forensics are diallelic because the population frequencies of two polymorphic forms can usually be determined with greater accuracy than those of multiple polymorphic forms at multi-allelic loci.
The capacity to identify a distinguishing or unique set of forensic markers in an individual is useful for forensic analysis. For example, one can determine whether a blood sample from a suspect matches a blood or other tissue sample from a crime scene by determining whether the set of polymorphic forms occupying selected polymorphic sites is the same in the suspect and the sample. If the set of polymorphic markers does not match between a suspect and a sample, it can be concluded (barring experimental error) that the suspect was not the source of the sample. If the set of markers does match, one can conclude that the DNA from the suspect is consistent with that found at the crime scene. If frequencies of the polymorphic forms at the loci tested have been determined (e.g., by analysis of a suitable population of individuals), one can perform a statistical analysis to determine the probability that a match of suspect and crime scene sample would occur by chance.
p(ID) is the probability that two random individuals have the same polymorphic or allelic form at a given polymorphic site. In diallelic loci, four genotypes are possible: AA, AB, BA, and BB. If alleles A and B occur in a haploid genome of the organism with frequencies x and y, the probability of each genotype in a diploid organism are (see WO 95/12607):
Homozygote: p(AA)=x.sup.2
Homozygote: p(BB)=y.sup.2 =(1-x).sup.2
Single Heterozygote: p(AB)=p(BA)=xy=x(1-x)
Both Heterozygotes: p(AB+BA)=2xy=2x(1-x)
The probability of identity at one locus (i.e, the probability that two individuals, picked at random from a population will have identical polymorphic forms at a given locus) is given by the equation:
p(ID)=(x.sup.2).sup.2 +(2xy).sup.2 +(y.sup.2).sup.2.
These calculations can be extended for any number of polymorphic forms at a given locus. For example, the probability of identity p(ID) for a 3-allele system where the alleles have the frequencies in the population of x, y and z, respectively, is equal to the sum of the squares of the genotype frequencies:
p(ID)=x.sup.4 +(2xy).sup.2 +(2yz).sup.2 +(2xz).sup.2 +z.sup.4 +y.sup.4
In a locus of n alleles, the appropriate binomial expansion is used to calculate p(ID) and p(exc).
The cumulative probability of identity (cum p(ID)) for each of multiple unlinked loci is determined by multiplying the probabilities provided by each locus.
cum p(ID)=p(ID1)p(ID2)p(ID3) . . . p(IDn)
The cumulative probability of non-identity for n loci (i.e. the probability that two random individuals will be different at 1 or more loci) is given by the equation:
cum p(nonID)=1-cum p(ID).
If several polymorphic loci are tested, the cumulative probability of non-identity for random individuals becomes very high (e.g., one billion to one). Such probabilities can be taken into account together with other evidence in determining the guilt or innocence of the suspect.
B. Paternity Testing
The object of paternity testing is usually to determine whether a male is the father of a child. In most cases, the mother of the child is known and thus, the mother's contribution to the child's genotype can be traced. Paternity testing investigates whether the part of the child's genotype not attributable to the mother is consistent with that of the putative father. Paternity testing can be performed by analyzing sets of polymorphisms in the putative father and the child.
If the set of polymorphisms in the child attributable to the father does not match the putative father, it can be concluded, barring experimental error, that the putative father is not the real father. If the set of polymorphisms in the child attributable to the father does match the set of polymorphisms of the putative father, a statistical calculation can be performed to determine the probability of coincidental match.
The probability of parentage exclusion (representing the probability that a random male will have a polymorphic form at a given polymorphic site that makes him incompatible as the father) is given by the equation (see WO 95/12607):
p(exc)=xy(1-xy)
where x and y are the population frequencies of alleles A and B of a diallelic polymorphic site.
(At a triallelic site p(exc)=xy(1-xy)+yz(1-yz)+xz(1-xz)+3xyz(1-xyz))), where x, y and z and the respective population frequencies of alleles A, B and C).
The probability of non-exclusion is
p(non-exc)=1-p(exc)
The cumulative probability of non-exclusion (representing the value obtained when n loci are used) is thus:
cum p(non-exc)=p(non-exc1)p(non-exc2)p(non-exc3) . . . p(non-excn)
The cumulative probability of exclusion for n loci (representing the probability that a random male will be excluded)
cum p(exc)=1-cum p(non-exc).
If several polymorphic loci are included in the analysis, the cumulative probability of exclusion of a random male is very high. This probability can be taken into account in assessing the liability of a putative father whose polymorphic marker set matches the child's polymorphic marker set attributable to his/her father.
C. Correlation of Polymorphisms with Phenotypic Traits
The polymorphisms of the invention may contribute to the phenotype of an organism in different ways. Some polymorphisms occur within a protein coding sequence and contribute to phenotype by affecting protein structure. The effect may be neutral, beneficial or detrimental, or both beneficial and detrimental, depending on the circumstances. For example, a heterozygous sickle cell mutation confers resistance to malaria, but a homozygous sickle cell mutation is usually lethal. Other polymorphisms occur in noncoding regions but may exert phenotypic effects indirectly via influence on replication, transcription, and translation. A single polymorphism may affect more than one phenotypic trait. Likewise, a single phenotypic trait may be affected by polymorphisms in different genes. Further, some polymorphisms predispose an individual to a distinct mutation that is causally related to a certain phenotype.
Phenotypic traits include diseases that have known but hitherto unmapped genetic components. Phenotypic traits also include symptoms of, or susceptibility to, multifactorial diseases of which a component is or may be genetic, such as autoimmune diseases, inflammation, cancer, diseases of the nervous system, and infection by pathogenic microorganisms. Some examples of autoimmune diseases include rheumatoid arthritis, multiple sclerosis, diabetes (insulin-dependent and non-independent), systemic lupus erythematosus and Graves disease. Some examples of cancers include cancers of the bladder, brain, breast, colon, esophagus, kidney, leukemia, liver, lung, oral cavity, ovary, pancreas, prostate, skin, stomach and uterus. Phenotypic traits also include characteristics such as longevity, appearance (e.g., baldness, obesity), strength, speed, endurance, fertility, and susceptibility or receptivity to particular drugs or therapeutic treatments.
Correlation is performed for a population of individuals who have been tested for the presence or absence of a phenotypic trait of interest and for polymorphic markers sets. To perform such analysis, the presence or absence of a set of polymorphisms (i.e. a polymorphic set) is determined for a set of the individuals, some of whom exhibit a particular trait, and some of which exhibit lack of the trait. The alleles of each polymorphism of the set are then reviewed to determine whether the presence or absence of a particular allele is associated with the trait of interest. Correlation can be performed by standard statistical methods such as a κ-squared test and statistically significant correlations between polymorphic form(s) and phenotypic characteristics are noted. For example, it might be found that the presence of allele A1 at polymorphism A correlates with heart disease. As a further example, it might be found that the combined presence of allele A1 at polymorphism A and allele B1 at polymorphism B correlates with increased milk production of a farm animal.
Such correlations can be exploited in several ways. In the case of a strong correlation between a set of one or more polymorphic forms and a disease for which treatment is available, detection of the polymorphic form set in a human or animal patient may justify immediate administration of treatment, or at least the institution of regular monitoring of the patient. Detection of a polymorphic form correlated with serious disease in a couple contemplating a family may also be valuable to the couple in their reproductive decisions. For example, the female partner might elect to undergo in vitro fertilization to avoid the possibility of transmitting such a polymorphism from her husband to her offspring. In the case of a weaker, but still statistically significant correlation between a polymorphic set and human disease, immediate therapeutic intervention or monitoring may not be justified. Nevertheless, the patient can be motivated to begin simple life-style changes (e.g., diet, exercise) that can be accomplished at little cost to the patient but confer potential benefits in reducing the risk of conditions to which the patient may have increased susceptibility by virtue of variant alleles. Identification of a polymorphic set in a patient correlated with enhanced receptiveness to one of several treatment regimes for a disease indicates that this treatment regime should be followed.
For animals and plants, correlations between characteristics and phenotype are useful for breeding for desired characteristics. For example, Beitz et al., U.S. Pat. No. 5,292,639 discuss use of bovine mitochondrial polymorphisms in a breeding program to improve milk production in cows. To evaluate the effect of mtDNA D-loop sequence polymorphism on milk production, each cow was assigned a value of 1 if variant or 0 if wildtype with respect to a prototypical mitochondrial DNA sequence at each of 17 locations considered. Each production trait was analyzed individually with the following animal model:
Y.sub.ijkpn =μ+YS.sub.i +P.sub.j +X.sub.k +β.sub.1 + . . . β.sub.17 +PE.sub.n +a.sub.n +e.sub.p
where Yijknp is the milk, fat, fat percentage, SNF, SNF percentage, energy concentration, or lactation energy record; μ is an overall mean; YSi is the effect common to all cows calving in year-season; Xk is the effect common to cows in either the high or average selection line; β1 to β17 are the binomial regressions of production record on mtDNA D-loop sequence polymorphisms; PEn is permanent environmental effect common to all records of cow n; an is effect of animal n and is composed of the additive genetic contribution of sire and dam breeding values and a Mendelian sampling effect; and ep is a random residual. It was found that eleven of seventeen polymorphisms tested influenced at least one production trait. Bovines having the best polymorphic forms for milk production at these eleven loci are used as parents for breeding the next generation of the herd.
D. Genetic Mapping of Phenotypic Traits
The previous section concerns identifying correlations between phenotypic traits and polymorphisms that directly or indirectly contribute to those traits. The present section describes identification of a physical linkage between a genetic locus associated with a trait of interest and polymorphic markers that are not associated with the trait, but are in physical proximity with the genetic locus responsible for the trait and co-segregate with it. Such analysis is useful for mapping a genetic locus associated with a phenotypic trait to a chromosomal position, and thereby cloning gene(s) responsible for the trait. See Lander et al., Proc. Natl. Acad. Sci. (USA) 83, 7353-7357 (1986); Lander et al., Proc. Natl. Acad. Sci. (USA) 84, 2363-2367 (1987); Donis-Keller et al., Cell 51, 319-337 (1987); Lander et al., Genetics 121, 185-199 (1989)). Genes localized by linkage can be cloned by a process known as directional cloning. See Wainwright, Med. J. Australia 159, 170-174 (1993); Collins, Nature Genetics 1, 3-6 (1992) (each of which is incorporated by reference in its entirety for all purposes).
Linkage studies are typically performed on members of a family. Available members of the family are characterized for the presence or absence of a phenotypic trait and for a set of polymorphic markers. The distribution of polymorphic markers in an informative meiosis is then analyzed to determine which polymorphic markers co-segregate with a phenotypic trait. See, e.g., Kerem et al., Science 245, 1073-1080 (1989); Monaco et al., Nature 316, 842 (1985); Yamoka et al., Neurology 40, 222-226 (1990); Rossiter et al., FASEB Journal 5, 21-27 (1991).
Linkage is analyzed by calculation of LOD (log of the odds) values. A lod value is the relative likelihood of obtaining observed segregation data for a marker and a genetic locus when the two are located at a recombination fraction θ, versus the situation in which the two are not linked, and thus segregating independently (Thompson & Thompson, Genetics in Medicine (5th ed, W.B. Saunders Company, Philadelphia, 1991); Strachan, "Mapping the human genome" in The Human Genome (BIOS Scientific Publishers Ltd, Oxford), Chapter 4). A series of likelihood ratios are calculated at various recombination fractions (θ), ranging from θ=0.0 (coincident loci) to θ=0.50 (unlinked). Thus, the likelihood at a given value of θ is: probability of data if loci linked at θ to probability of data if loci unlinked. The computed likelihoods are usually expressed as the log10 of this ratio (i.e., a lod score). For example, a lod score of 3 indicates 1000:1 odds against an apparent observed linkage being a coincidence. The use of logarithms allows data collected from different families to be combined by simple addition. Computer programs are available for the calculation of lod scores for differing values of θ (e.g., LIPED, MLINK (Lathrop, Proc. Nat. Acad. Sci. (USA) 81, 3443-3446 (1984)). For any particular lod score, a recombination fraction may be determined from mathematical tables. See Smith et al., Mathematical tables for research workers in human genetics (Churchill, London, 1961); Smith, Ann. Hum. Genet. 32, 127-150 (1968). The value of θ at which the lod score is the highest is considered to be the best estimate of the recombination fraction.
Positive lod score values suggest that the two loci are linked, whereas negative values suggest that linkage is less likely (at that value of θ) than the possibility that the two loci are unlinked. By convention, a combined lod score of +3 or greater (equivalent to greater than 1000:1 odds in favor of linkage) is considered definitive evidence that two loci are linked. Similarly, by convention, a negative lod score of -2 or less is taken as definitive evidence against linkage of the two loci being compared. Negative linkage data are useful in excluding a chromosome or a segment thereof from consideration. The search focuses on the remaining non-excluded chromosomal locations.
IV. Modified Polypeptides and Gene Sequences
The invention further provides variant forms of nucleic acids and corresponding proteins. The nucleic acids comprise at least ten contiguous bases of one of the sequences described in TABLE 2 (SEQ ID NOS:1 and 2), TABLE 3 (SEQ ID NOS:3 and 4), TABLE 4 (SEQ ID NOS:5 and 6), TABLE 5 (SEQ ID NOS:7-15), TABLE 6 (SEQ ID NOS:16 and 17), TABLE 7 (SEQ ID NOS:18 and 19), TABLE 8 (SEQ ID NOS:20 and 21), TABLE 9 (SEQ ID NOS:22-24), TABLE 10 (SEQ ID NOS:25-27) and TABLE 11 (SEQ ID NOS:28 and 29). designated M1-M10. Some nucleic acid encode full-length variant forms of proteins. Similarly, variant proteins have the prototypical amino acid sequences of encoded by nucleic acid sequence shown in Tables 2-11, designated M1-M10 (read so as to be in-frame with the full-length coding sequence of which it is a component).
Variant genes can be expressed in an expression vector in which a variant gene is operably linked to a native or other promoter. Usually, the promoter is a eukaryotic promoter for expression in a mammalian cell. The transcription regulation sequences typically include a heterologous promoter and optionally an enhancer which is recognized by the host. The selection of an appropriate promoter, for example trp, lac, phage promoters, glycolytic enzyme promoters and tRNA promoters, depends on the host selected. Commercially available expression vectors can be used. Vectors can include host-recognized replication systems, amplifiable genes, selectable markers, host sequences useful for insertion into the host genome, and the like.
The means of introducing the expression construct into a host cell varies depending upon the particular construction and the target host. Suitable means include fusion, conjugation, transfection, transduction, electroporation or injection, as described in Sambrook, supra. A wide variety of host cells can be employed for expression of the variant gene, both prokaryotic and eukaryotic. Suitable host cells include bacteria such as E. coli, yeast, filamentous fungi, insect cells, mammalian cells, typically immortalized, e.g., mouse, CHO, human and monkey cell lines and derivatives thereof. Preferred host cells are able to process the variant gene product to produce an appropriate mature polypeptide. Processing includes glycosylation, ubiquitination, disulfide bond formation, general post-translational modification, and the like.
The protein may be isolated by conventional means of protein biochemistry and purification to obtain a substantially pure product, i.e., 80, 95 or 99% free of cell component contaminants, as described in Jacoby, Methods in Enzymology Volume 104, Academic Press, New York (1984); Scopes, Protein Purification, Principles and Practice, 2nd Edition, Springer-Verlag, New York (1987); and Deutscher (ed), Guide to Protein Purification, Methods in Enzymology, Vol. 182 (1990). If the protein is secreted, it can be isolated from the supernatant in which the host cell is grown. If not secreted, the protein can be isolated from a lysate of the host cells.
The invention further provides transgenic nonhuman animals capable of expressing an exogenous variant gene and/or having one or both alleles of an endogenous variant gene inactivated. Expression of an exogenous variant gene is usually achieved by operably linking the gene to a promoter and optionally an enhancer, and microinjecting the construct into a zygote. See Hogan et al., "Manipulating the Mouse Embryo, A Laboratory Manual," Cold Spring Harbor Laboratory. Inactivation of endogenous variant genes can be achieved by forming a transgene in which a cloned variant gene is inactivated by insertion of a positive selection marker. See Capecchi, Science 244, 1288-1292 (1989). The transgene is then introduced into an embryonic stem cell, where it undergoes homologous recombination with an endogenous variant gene. Mice and other rodents are preferred animals. Such animals provide useful drug screening systems.
In addition to substantially full-length polypeptides expressed by variant genes, the present invention includes biologically active fragments of the polypeptides, or analogs thereof, including organic molecules which simulate the interactions of the peptides. Biologically active fragments include any portion of the full-length polypeptide which confers a biological function on the variant gene product, including ligand binding, and antibody binding. Ligand binding includes binding by nucleic acids, proteins or polypeptides, small biologically active molecules, or large cellular structures.
Polyclonal and/or monoclonal antibodies that specifically bind to variant gene products but not to corresponding prototypical gene products are also provided. Antibodies can be made by injecting mice or other animals with the variant gene product or synthetic peptide fragments thereof. Monoclonal antibodies are screened as are described, for example, in Harlow & Lane, Antibodies, A Laboratory Manual, Cold Spring Harbor Press, New York (1988); Goding, Monoclonal antibodies, Principles and Practice (2d ed.) Academic Press, New York (1986). Monoclonal antibodies are tested for specific immunoreactivity with a variant gene product and lack of immunoreactivity to the corresponding prototypical gene product. These antibodies are useful in diagnostic assays for detection of the variant form, or as an active ingredient in a pharmaceutical composition.
V. Kits
The invention further provides kits comprising at least one allele-specific oligonucleotide as described above. Often, the kits contain one or more pairs of allele-specific oligonucleotides hybridizing to different forms of a polymorphism. In some kits, the allele-specific oligonucleotides are provided immobilized to a substrate. For example, the same substrate can comprise allele-specific oligonucleotide probes for detecting at least 10, 100 or all of the polymorphisms shown in Tables 2-11. Optional additional components of the kit include, for example, restriction enzymes, reverse-transcriptase or polymerase, the substrate nucleoside triphosphates, means used to label (for example, an avidinenzyme conjugate and enzyme substrate and chromogen if the label is biotin), and the appropriate buffers for reverse transcription, PCR, or hybridization reactions. Usually, the kit also contains instructions for carrying out the methods.
EXAMPLES
The polymorphisms set forth in this application were identified by hybridization to tiling arrays. Tiling arrays are described in PCT/US94/12305 (incorporated by reference in its entirety for all purposes). Tiling generally means the synthesis of a defined set of oligonucleotide probes that is made up of a sequence complementary to the sequence to be analyzed (the "target sequence"), as well as preselected variations of that sequence. The variations usually include substitution at one or more base positions with one or more nucleotides. Tiling strategies are discussed in WO 95/11995 (incorporated by reference in its entirety for all purposes). With a tiled array containing 4L probes one can query every position in a nucleotide containing L number of bases. A 4L tiled array, for example, contains L number of sets of 4 probes, i.e. 4L probes. Each set of 4 probes contains the perfect complement to a portion of the target sequence with a single substitution for each nucleotide at the same position in the probe. See also Chee, M., et. al., Science, October, 1996.
To detect the novel sequence tagged polymorphic sites provided in this application, we designed a P25,13 (25-mer probes having the interrogation position at base 13) 4L tiling array for the G6PD locus. Because the G6PD locus contains a large number of Alu sequences (repeat sequences), we simplified the tiled probe array by not probing the repetitive Alu sequences. To generate target sequence fragments, blood was collected from 10 individuals. Long range PCR amplification was carried out on genomic DNA. The amplicons were labeled, fragmented, and used to determine hybridization to the array.
All publications and patent applications cited above are incorporated by reference in their entirety for all purposes to the same extent as if each individual publication or patent application were specifically and individually indicated to be so incorporated by reference. Although the present invention has been described in some detail by way of illustration and example for purposes of clarity and understanding, it will be apparent that certain changes and modifications may be practiced within the scope of the appended claims.
              TABLE 1
______________________________________
1      2       3     4     5   6   7   8     9   10
______________________________________
M1   G     G       C   T     C   T   G   C     G   G
M2   A     A       C   T     C   A   T   C     G   G
M3   A     A       C   T     C   A   T   C     G   G
M4   A     A       C   G     C   A   G   C     G   A
M5   G     G       G   T     C   A   G   C     G   G
M6   A     A       C   T     T   A   G   C     A   G
M7   G     G       C   T     C   A   G   C     G   G
M8   G     G       C   T     C   A   G   C     G   G
M9   A     A       C   T     T   A   G   C     A   G
M10  G     G       C   T     C   A   G   T     G   G
______________________________________
                                  TABLE 2
__________________________________________________________________________
                                                 SEQ ID
__________________________________________________________________________
                                                 NO:
starting sequence
         T G A G C A A C A G T G G A A A T T T G 1
M1       T G A G C A A C A G T G G A A A T T      T
                                           G      1
M10      T G A G C A A C A G T G G A A A T T      T
                                           G      1
M2       T G A G C A A C A A T G G A A A T T      T
                                           G      2
M3       T G A G C A A C A A T G G A A A T T      T
                                           G      2
M4       T G A G C A A C A A T G G A A A T T      T
                                           G      2
M5       T G A G C A A C A G T G G A A A T T      T
                                           G      1
M6       T G A G C A A C A A T G G A A A T T      T
                                           G      2
M7       T G A G C A A C A G T G G A A A T T      T
                                           G      1
M8       T G A G C A A C A G T G G A A A T T      T
                                           G      1
M9       T G A G C A A C A A T G G A A A T T      T
                                           G      2
__________________________________________________________________________
                                  TABLE 3
__________________________________________________________________________
                                                 SEQ ID
__________________________________________________________________________
                                                 NO:
starting sequence
         G C A G T T T G A G T G T C T C T G G T 3
M1       G C A G T T T G A G T G T C T C T G      G
                                           T      3
M10      G C A G T T T G A G T G T C T C T G      G
                                           T      3
M2       G C A G T T T G A A T G T C T C T G      G
                                           T      4
M3       G C A G T T T G A A T G T C T C T G      G
                                           T      4
M4       G C A G T T T G A A T G T C T C T G      G
                                           T      4
M5       G C A G T T T G A G T G T C T C T G      G
                                           T      3
M6       G C A G T T T G A A T G T C T C T G      G
                                           T      4
M7       G C A G T T T G A G T G T C T C T G      G
                                           T      3
M8       G C A G T T T G A G T G T C T C T G      G
                                           T      3
M9       G C A G T T T G A A T G T C T C T G      G
                                           T      4
__________________________________________________________________________
                                  TABLE 4
__________________________________________________________________________
                                                 SEQ ID
__________________________________________________________________________
                                                 NO:
starting sequence
         G T A A A T G C T C T G C A A A T A A C 5
M1       G T A A A T G C T C T G C A A A T A      A
                                           C      5
M10      G T A A A T G C T C T G C A A A T A      A
                                           C      5
M2       G T A A A T G C T C T G C A A A T A      A
                                           C      5
M3       G T A A A T G C T C T G C A A A T A      A
                                           C      5
M4       G T A A A T G C T C T G C A A A T A      A
                                           C      5
M5       G T N A N T N C T G N G C A A N T A      N
                                           C      6
M6       G T A A A T G C T C T G C A A A T A      A
                                           C      5
M7       G T A A A T G C T C T G C A A A T A      A
                                           C      5
M8       G T A A A T G C T C T G C A A A T A      A
                                           C      5
M9       G T A A A T G C T C T G C A A A T A      A
                                           C      5
__________________________________________________________________________
                                  TABLE 5
__________________________________________________________________________
                                                 SEQ ID
__________________________________________________________________________
                                                 NO:
starting sequence
         G G C T C C A A G C G G T G C C C G G C 7
M1       G G C T C C A A G C G G T G C N C G      N
                                           C      8
M10      G G C T C C A A G C G G T G C C C G      G
                                           C      7
M2       G G C T C C A A G C G G T G N N C G      N
                                           C      9
M3       G G C T C C A A G C G G T G C N N G      N
                                           C      10
M4       G G C T C C A A G C G G T G C C C G      N
                                           C      11
M5       G G C T C C A A G C G G T G C N N G      G
                                           N      12
M6       G G C T C N N N N T N G N N N N N N      N
                                           C      13
M7       G G C T C C A A G C G G T G C N C G      N
                                           C      8
M8       G G C T C C A A G C G G T G C N C G      G
                                           C      14
M9       G G C T C C N A A T G G T N N N N G      N
                                           C      15
__________________________________________________________________________
                                  TABLE 6
__________________________________________________________________________
                                                 SEQ ID
__________________________________________________________________________
                                                 NO:
starting sequence
         G A C C T C T T T A G C T C G T T A T T 16
M1       G A C C T C T T T T G C T C G T T A      T
                                           T      17
M10      G A C C T C T T T A G C T C G T T A      T
                                           T      16
M2       G A C C T C T T T A G C T C G T T A      T
                                           T      16
M3       G A C C T C T T T A G C T C G T T A      T
                                           T      16
M4       G A C C T C T T T A G C T C G T T A      T
                                           T      16
M5       G A C C T C T T T A G C T C G T T A      T
                                           T      16
M6       G A C C T C T T T A G C T C G T T A      T
                                           T      16
M7       G A C C T C T T T A G C T C G T T A      T
                                           T      16
M8       G A C C T C T T T A G C T C G T T A      T
                                           T      16
M9       G A C C T C T T T A G C T C G T T A      T
                                           T      16
__________________________________________________________________________
                                  TABLE 7
__________________________________________________________________________
                                                 SEQ ID
__________________________________________________________________________
                                                 NO:
starting sequence
         G G G C C T C A A G A T T T G A T T T C 18
M1       G G G C C T C A A G A T T T G A T T      T
                                           C      18
M10      G G G C C T C A A G A T T T G A T T      T
                                           C      18
M2       G G G C C T C A N T T T T T G A T T      T
                                           C      19
M3       G G G C C T C A N T T T T T G A T T      T
                                           C      19
M4       G G G C C T C A A G A T T T G A T T      T
                                           C      18
M5       G G G C C T C A A G A T T T G A T T      T
                                           C      18
M6       G G G C C T C A A G A T T T G A T T      T
                                           C      18
M7       G G G C C T C A A G A T T T G A T T      T
                                           C      18
M8       G G G C C T C A A G A T T T G A T T      T
                                           C      18
M9       G G G C C T C A A G A T T T G A T T      T
                                           C      18
__________________________________________________________________________
                                  TABLE 8
__________________________________________________________________________
                                                 SEQ ID
__________________________________________________________________________
                                                 NO:
starting sequence
         A G G G G G G C T T T T T C C A G C T C 20
M1       A G G G G G G C T C T T T C C A G C      T
                                           C      21
M10      A G G G G G G C T T T T T C C A G C      T
                                           C      20
M2       A G G G G G G C T C T T T C C A G C      T
                                           C      21
M3       A G G G G G G C T C T T T C C A G C      T
                                           C      21
M4       A G G G G G G C T C T T T C C A G C      T
                                           C      21
M5       A G G G G G G C T C T T T C C A G C      T
                                           C      21
M6       A G G G G G G C T C T T T C C A G C      T
                                           C      21
M7       A G G G G G G C T C T T T C C A G C      T
                                           C      21
M8       A G G G G G G C T C T T T C C A G C      T
                                           C      21
M9       A G G G G G G C T C T T T C C A G C      T
                                           C      21
__________________________________________________________________________
                                  TABLE 9
__________________________________________________________________________
                                                 SEQ ID
__________________________________________________________________________
                                                 NO:
starting sequence
         G C C T C C T T C G T T C T A C G A C A 22
M1       G C C T C C T T C G T T C T A C G A      C
                                           A      22
M10      G C C T C C T T C G T T C T A C G A      C
                                           A      22
M2       G C C T C C T T C G T T C T A C G A      C
                                           A      22
M3       G C C T C C T T C G T T C T A C G A      C
                                           A      22
M4       G C C T C C T T C G T T C T A C G A      C
                                           A      22
M5       G C C T C C T T C G T T C T A C G A      C
                                           A      22
M6       G C C T C C T T N A T T C T A C G A      C
                                           A      23
M7       G C C T C C T T C G T T C T A C G A      C
                                           A      22
M8       G C C T C C T T C G T T C T A C G A      C
                                           A      22
M9       G C C T C C T T C A T T C T A C G A      C
                                           A      24
__________________________________________________________________________
                                  TABLE 10
__________________________________________________________________________
                                                 SEQ ID
__________________________________________________________________________
                                                 NO:
starting sequence
         A G G G T G C G C G T C C T C A C C T G 25
M1       A G G G T G C G C G T C C T C A C C      T
                                           G      25
M10      A G G G T G C G C G T C C T C A C C      T
                                           G      25
M2       A G G G T G C G C G T C C T C A C C      T
                                           G      25
M3       A G G G T G C G C G T C C T C A C C      T
                                           G      25
M4       A G N G T N C G N A T C C T C A C C      T
                                           G      26
M5       N G G G T G C G C G T C C T C A N C      T
                                           G      27
M6       A G G G T G C G C G T C C T C A C C      T
                                           G      25
M7       A G G G T G C G C G T C C T C A C C      T
                                           G      25
M8       A G G G T G C G C G T C C T C A C C      T
                                           G      25
M9       A G G G T G C G C G T C C T C A C C      T
                                           G      25
__________________________________________________________________________
                                  TABLE 11
__________________________________________________________________________
                                                 SEQ ID
__________________________________________________________________________
                                                 NO:
starting sequence
         A A C C A G A A T T T A T T   T G A G G 28
M1       A A C C A G A A T T T A T T T T G A      G
                                           G      28
M10      A A C C A G A A T T T A T T T T G A      G
                                           G      28
M2       A A C C A G A A T T T A T T T T G A      G
                                           G      28
M3       A A C C A G A A T T T A T T T T G A      G
                                           G      28
M4       A A C C A G A A T G T A T T T T G A      G
                                           G      29
M5       A A C C A G A A T T T A T T T T G A      G
                                           G      28
M6       A A C C A G A A T T T A T T T T G A      G
                                           G      28
M7       A A C C A G A A T T T A T T T T G A      G
                                           G      28
M8       A A C C A G A A T T T A T T T T G A      G
                                           G      28
M9       A A C C A G A A T T T A T T T T G A      G
                                           G      28
__________________________________________________________________________
__________________________________________________________________________
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(iii) NUMBER OF SEQUENCES: 29
(2) INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:
TGAGCAACAGTGGAAATTTG20
(2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
TGAGCAACAATGGAAATTTG20
(2) INFORMATION FOR SEQ ID NO:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:
GCAGTTTGAGTGTCTCTGGT20
(2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:
GCAGTTTGAATGTCTCTGGT20
(2) INFORMATION FOR SEQ ID NO:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:
GTAAATGCTCTGCAAATAAC20
(2) INFORMATION FOR SEQ ID NO:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:
GTNANTNCTGNGCAANTANC20
(2) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:
GGCTCCAAGCGGTGCCCGGC20
(2) INFORMATION FOR SEQ ID NO:8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:
GGCTCCAAGCGGTGCNCGNC20
(2) INFORMATION FOR SEQ ID NO:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:
GGCTCCAAGCGGTGNNCGNC20
(2) INFORMATION FOR SEQ ID NO:10:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:
GGCTCCAAGCGGTGCNNGNC20
(2) INFORMATION FOR SEQ ID NO:11:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:
GGCTCCAAGCGGTGCCCGNC20
(2) INFORMATION FOR SEQ ID NO:12:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:
GGCTCCAAGCGGTGCNNGGN20
(2) INFORMATION FOR SEQ ID NO:13:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:
GGCTCNNNNTNGNNNNNNNC20
(2) INFORMATION FOR SEQ ID NO:14:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:
GGCTCCAAGCGGTGCNCGGC20
(2) INFORMATION FOR SEQ ID NO:15:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:
GGCTCCNAATGGTNNNNGNC20
(2) INFORMATION FOR SEQ ID NO:16:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:
GACCTCTTTAGCTCGTTATT20
(2) INFORMATION FOR SEQ ID NO:17:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:
GACCTCTTTTGCTCGTTATT20
(2) INFORMATION FOR SEQ ID NO:18:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:
GGGCCTCAAGATTTGATTTC20
(2) INFORMATION FOR SEQ ID NO:19:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:
GGGCCTCANTATTTGATTTC20
(2) INFORMATION FOR SEQ ID NO:20:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:
AGGGGGGCTTTTTCCAGCTC20
(2) INFORMATION FOR SEQ ID NO:21:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:
AGGGGGGCTCTTTCCAGCTC20
(2) INFORMATION FOR SEQ ID NO:22:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:
GCCTCCTTCGTTCTACGACA20
(2) INFORMATION FOR SEQ ID NO:23:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:
GCCTCCTTNATTCTACGACA20
(2) INFORMATION FOR SEQ ID NO:24:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:
GCCTCCTTCATTCTACGACA20
(2) INFORMATION FOR SEQ ID NO:25:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:
AGGGTGCGCGTCCTCACCTG20
(2) INFORMATION FOR SEQ ID NO:26:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:26:
AGNGTNCGNATCCTCACCTG20
(2) INFORMATION FOR SEQ ID NO:27:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:27:
NGGGTGCGCGTCCTCANCTG20
(2) INFORMATION FOR SEQ ID NO:28:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:28:
AACCAGAATTTATTTTGAGG20
(2) INFORMATION FOR SEQ ID NO:29:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:29:
AACCAGAATGTATTTTGAGG20
__________________________________________________________________________

Claims (13)

What is claimed is:
1. An isolated nucleic acid segment of between 10 and 100 bases of which at least 10 contiguous bases including a polymorphic site are from a sequence selected from the group consisting of SEQ ID NOS:1-5, SEQ ID No:5 in which the C at position 10 is replaced by a G, SEQ ID No:7, SEQ ID No:7 in which the C at position 10 is replaced by a T, SEQ ID Nos:16-18, SEQ ID No:18 in which the G at position 10 is replaced by a T, SEQ ID Nos:20-22, SEQ ID Nos:24 and 25, SEQ ID No:25 in which the G at position 10 is replaced by an A, SEQ ID Nos:28 and 29, and the perfect complements thereof, wherein the polymorphic site occurs at position 10 in each of the SEQ. ID Nos.
2. The isolated nucleic acid segment of claim 1 that is DNA.
3. The isolated nucleic acid segment of claim 1 that is RNA.
4. The isolated nucleic acid segment of claim 1 that is less than 50 bases.
5. The isolated nucleic acid segment of claim 1 that is less than 20 bases.
6. The isolated nucleic acid segment of claim 1, wherein the ten contiguous bases are from a sequence selected from the group consisting of SEQ ID Nos:2 and 4, SEQ. ID. No:5 in which the C at position 10 is replaced by a G, SEQ ID No:7 in which the C at position 10 is replaced by a T, SEQ ID. No:17, SEQ ID No:18 in which the G at position 10 is replaced by a T, SEQ ID Nos:21 and 24, SEQ ID NO:25 in which the G at position 10 is replaced by an A, SEQ ID No:29, and the perfect complements thereof, wherein the polymorphic site occurs at position 10 in each of the SEQ ID NOS.
7. The isolated nucleic acid segment of claim 1, which is a probe, and wherein the polymorphic site occupies a central position of the probe.
8. The nucleic acid of claim 1, which is a primer and, wherein the polymorphic site occupies the 3' end of the primer.
9. An isolated nucleic acid fragment of a human X chromosome comprising at least 10 contiguous bases including a polymorphic site from a sequence selected from the group consisting of SEQ ID Nos:2 and 4, SEQ ID No:5 in which the C at position 10 is replaced by a G, SEQ ID No:7 in which the C at position 10 is replaced by a T, SEQ ID No:17, SEQ. ID. No:18 in which the G at position 10 is replaced by a T, SEQ ID NOS:21 and 24, SEQ ID NO:25 in which the G at position 10 is replaced by an A, SEQ ID NO:29, and the perfect complements thereof, wherein the polymorphic site occurs at position 10 in each of the SEQ ID NOS.
10. The isolated nucleic acid fragment of a human X-chromosome of claim 9, comprising a sequence selected from the group consisting of SEQ ID NOS:2 and 4, SEQ ID NO:5 in which the C at position 10 is replaced by a G, SEQ ID NO:7 in which the C at position 10 is replaced by a T, SEQ ID NO: 17, SEQ. ID NO: 18 in which the G at position 10 is replaced by a T, SEQ ID NOS:21 and 24, SEQ ID NO: 25 in which the G at position 10 is replaced by an A, SEQ ID NO: 29, and the perfect complements thereof, wherein the polymorphic site occurs at position 10 in each of the SEQ. ID NOS.
11. A method of determining a base occupying a polymorphic site in a nucleic acid, comprising:
obtaining the nucleic acid from an individual; and
determining a base occupying a polymorphic site in a sequence selected from the group consisting of SEQ ID NOS:2 and 4, SEQ ID NO:5 in which the C at position 10 is replaced by a G, SEQ ID NO:7 in which the C at position 10 is replaced by a T, SEQ ID NO:17, SEQ. ID NO:18 in which the G at position 10 is replaced by a T, SEQ ID NOS:21 and 24, SEQ ID NO:25 in which the G at position 10 is replaced by an A, SEQ ID NO:29, and the perfect complements thereof, wherein the polymorphic site occurs at position 10 in each of the SEQ ID NOS.
12. The method of claim 11, wherein the determining comprises determining a set of bases occupying a set of polymorphic sites in a set of sequences selected from the group consisting of SEQ ID NOS:2 and 4, SEQ ID NO:5 in which the C at position 10 is replaced by a G, SEQ ID NO:7 in which the C at position 10 is replaced by a T, SEQ ID NO: 17, SEQ. ID NO: 18 in which the G at position 10 is replaced by a T, SEQ ID NOS:21 and 24, SEQ ID NO:25 in which the G at position 10 is replaced by an A, SEQ ID NO:29, and the perfect complements thereof, wherein the polymorphic site occurs at position 10 in each of the SEQ. ID NOS.
13. The method of claim 12, wherein the nucleic acid is obtained from a plurality of individuals, and a base occupying one of the polymorphic sites is determined in each of the individuals, and the method further comprising testing each individual for the presence of a disease phenotype, and correlating the presence of the disease phenotype with the base.
US08/813,508 1996-10-28 1997-03-07 Polymorphisms in the glucose-6 phosphate dehydrogenase locus Expired - Lifetime US5856104A (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
US08/813,508 US5856104A (en) 1996-10-28 1997-03-07 Polymorphisms in the glucose-6 phosphate dehydrogenase locus
PCT/US1997/019665 WO1998018967A1 (en) 1996-10-28 1997-10-27 Polymorphisms in the glucose-6 phosphate dehydrogenase locus
AU51554/98A AU5155498A (en) 1996-10-28 1997-10-27 Polymorphisms in the glucose-6 phosphate dehydrogenase locus

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US2937496P 1996-10-28 1996-10-28
US08/813,508 US5856104A (en) 1996-10-28 1997-03-07 Polymorphisms in the glucose-6 phosphate dehydrogenase locus

Publications (1)

Publication Number Publication Date
US5856104A true US5856104A (en) 1999-01-05

Family

ID=26704886

Family Applications (1)

Application Number Title Priority Date Filing Date
US08/813,508 Expired - Lifetime US5856104A (en) 1996-10-28 1997-03-07 Polymorphisms in the glucose-6 phosphate dehydrogenase locus

Country Status (3)

Country Link
US (1) US5856104A (en)
AU (1) AU5155498A (en)
WO (1) WO1998018967A1 (en)

Cited By (57)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6268136B1 (en) 1997-06-16 2001-07-31 Exact Science Corporation Methods for stool sample preparation
US20020012930A1 (en) * 1999-09-16 2002-01-31 Rothberg Jonathan M. Method of sequencing a nucleic acid
US20020018199A1 (en) * 1999-11-04 2002-02-14 Martin Blumenfeld Imaging of biological samples using electronic light detector
WO2002016625A2 (en) 2000-08-25 2002-02-28 Basf Plant Science Gmbh Plant polynucleotides encoding prenyl proteases
US6406857B1 (en) 1997-06-16 2002-06-18 Exact Sciences Corporation Methods for stool sample preparation
WO2002064612A2 (en) 2001-02-09 2002-08-22 Human Genome Sciences, Inc. Human g-protein chemokine receptor (ccr5) hdgnr10
US20030022207A1 (en) * 1998-10-16 2003-01-30 Solexa, Ltd. Arrayed polynucleotides and their use in genome analysis
US20030064372A1 (en) * 2000-06-22 2003-04-03 Bodnar Jackie S. Gene and sequence variation associated with lipid disorder
US6551777B1 (en) 1999-02-25 2003-04-22 Exact Sciences Corporation Methods for preserving DNA integrity
US6586177B1 (en) 1999-09-08 2003-07-01 Exact Sciences Corporation Methods for disease detection
US6589726B1 (en) 1991-09-04 2003-07-08 Metrigen, Inc. Method and apparatus for in situ synthesis on a solid support
US6596509B1 (en) 1998-07-10 2003-07-22 Cornell Research Foundation, Inc. Recombinant constructs and systems for secretion of proteins via type III secretion systems
US20030151735A1 (en) * 1999-11-04 2003-08-14 Martin Blumenfeld Scanning of biological samples
US20030170679A1 (en) * 2001-11-09 2003-09-11 Wood Linda Susan Single nucleotide polymorphisms in GH-1
US20030170667A1 (en) * 2001-08-28 2003-09-11 Kaytes Paul S. Single nucleotide polymorphisms diagnostic for schizophrenia
US20030224365A1 (en) * 2001-04-24 2003-12-04 Wood Linda Susan Single nucleotide polymorphisms diagnostic for schizophrenia
US20030224413A1 (en) * 1998-11-17 2003-12-04 Shimkets Richard A. Nucleic acids containing single nucleotide polymorphisms and methods of use thereof
US6670464B1 (en) 1998-11-17 2003-12-30 Curagen Corporation Nucleic acids containing single nucleotide polymorphisms and methods of use thereof
US20040043467A1 (en) * 1999-12-07 2004-03-04 Shuber Anthony P. Supracolonic aerodigestive neoplasm detection
US6703228B1 (en) 1998-09-25 2004-03-09 Massachusetts Institute Of Technology Methods and products related to genotyping and DNA analysis
US20040053260A1 (en) * 2000-07-24 2004-03-18 Gut Glynne Ivo Method for haplotyping by mass spectrometry
US20040106110A1 (en) * 1998-07-30 2004-06-03 Solexa, Ltd. Preparation of polynucleotide arrays
US20040115699A1 (en) * 2001-08-28 2004-06-17 Kaytes Paul S. Single nucleotide polymorphisms diagnostic for schizophrenia
US20040203032A1 (en) * 1998-09-28 2004-10-14 Whitehead Institute For Biomedical Research Pre-selection and isolation of single nucleotide polymorphisms
US20040223959A1 (en) * 2003-01-21 2004-11-11 Feder John N. Polynucleotide encoding a novel acyl coenzyme a, monoacylglycerol acyltransferase-3 (MGAT3), and uses thereof
US20040248161A1 (en) * 1999-09-16 2004-12-09 Rothberg Jonathan M. Method of sequencing a nucleic acid
US20040259101A1 (en) * 2003-06-20 2004-12-23 Shuber Anthony P. Methods for disease screening
US20050014935A1 (en) * 2003-07-17 2005-01-20 Chong-Sheng Yuan Methods and compositions for determination of glycated proteins
US6849403B1 (en) 1999-09-08 2005-02-01 Exact Sciences Corporation Apparatus and method for drug screening
US6919174B1 (en) 1999-12-07 2005-07-19 Exact Sciences Corporation Methods for disease detection
US20050227249A1 (en) * 1999-07-30 2005-10-13 Ulrich Brinkmann Polymorphisms in the human MDR-1 gene and their use in diagnostic and therapeutic applications
US6964846B1 (en) 1999-04-09 2005-11-15 Exact Sciences Corporation Methods for detecting nucleic acids indicative of cancer
US6986987B1 (en) * 1998-07-24 2006-01-17 The Uab Research Foundation Genetic polymorphism in the receptor for IgA
US7094609B2 (en) 1996-09-20 2006-08-22 Burstein Technologies, Inc. Spatially addressable combinatorial chemical arrays in encoded optical disk format
US20070009945A1 (en) * 2005-07-08 2007-01-11 Bristol-Myers Squibb Company Single nucleotide polymorphisms associated with dose-dependent edema and methods of use thereof
US20070042433A1 (en) * 2003-03-26 2007-02-22 Jianxin Bao Neuregulin protein regulation of synaptic proteins
US20070202512A1 (en) * 2005-08-19 2007-08-30 Bristol-Myers Squibb Company Human single nucleotide polymorphisms associated with dose-dependent weight gain and methods of use thereof
US20080004209A1 (en) * 2006-06-30 2008-01-03 Bristol-Myers Squibb Company Method for identifying HIV-1 protease inhibitors with reduced metabolic affects
US20080096230A1 (en) * 2006-07-25 2008-04-24 Chong-Sheng Yuan Methods for assaying percentage of glycated hemoglobin
US20080124714A1 (en) * 2004-05-14 2008-05-29 Exact Sciences Corporation Method for Stabilizing Biological Samples for Nucleic Acid Analysis
US20080131895A1 (en) * 2000-10-06 2008-06-05 Jingyue Ju Massive parallel method for decoding DNA and RNA
WO2008105797A2 (en) 2006-06-30 2008-09-04 Bristol-Myers Squibb Company Polynucleotides encoding novel pcsk9 variants
US20080299597A1 (en) * 2006-07-25 2008-12-04 Chong-Sheng Yuan Methods for assaying percentage of glycated hemoglobin
US20090162841A1 (en) * 2004-08-06 2009-06-25 Deutsches Krebsforschungszentrum Stifting Des Offentlichen Rechts Method of selecting a desired protein from a library
US20100025264A1 (en) * 2008-05-13 2010-02-04 Chong-Sheng Yuan Electrochemical biosensor for direct determination of percentage of glycated hemoglobin
US20100130368A1 (en) * 1998-07-30 2010-05-27 Shankar Balasubramanian Method and system for sequencing polynucleotides
US7776524B2 (en) 2002-02-15 2010-08-17 Genzyme Corporation Methods for analysis of molecular events
US20110014611A1 (en) * 2007-10-19 2011-01-20 Jingyue Ju Design and synthesis of cleavable fluorescent nucleotides as reversible terminators for dna sequences by synthesis
US20110020797A1 (en) * 2007-02-09 2011-01-27 Bristol-Myers Squibb Company Methods For Identifying Patients With An Increased Likelihood Of Responding To DPP-IV Inhibitors
US20110152340A1 (en) * 2008-05-16 2011-06-23 Bristol-Myers Squibb Company Methods for Identifying Subjects With an Increased Likelihood of Responding to DPP-IV Inhibitors
US8298792B2 (en) 2006-12-01 2012-10-30 The Trustees Of Columbia University In The City Of New York Four-color DNA sequencing by synthesis using cleavable fluorescent nucleotide reversible terminators
US9115163B2 (en) 2007-10-19 2015-08-25 The Trustees Of Columbia University In The City Of New York DNA sequence with non-fluorescent nucleotide reversible terminators and cleavable label modified nucleotide terminators
US9447454B2 (en) 2003-10-23 2016-09-20 The Rockefeller University Method of purifying RNA binding protein-RNA complexes
US9708358B2 (en) 2000-10-06 2017-07-18 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US10648026B2 (en) 2013-03-15 2020-05-12 The Trustees Of Columbia University In The City Of New York Raman cluster tagged molecules for biological imaging
US20210193256A1 (en) * 2017-10-18 2021-06-24 Centre National De La Recherche Scientifique (Cnrs) Method and system for generating a unique identifier of a subject from the dna of said subject
US11059968B2 (en) 2017-02-28 2021-07-13 Toyobo Co., Ltd. Polyester elastomer resin composition having improved mold fouling

Families Citing this family (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2328500A1 (en) * 1998-06-05 1999-12-16 Genset Polymorphic markers of prostate carcinoma tumor antigen-1 (pcta-1)
US6759192B1 (en) 1998-06-05 2004-07-06 Genset S.A. Polymorphic markers of prostate carcinoma tumor antigen-1(PCTA-1)
AU2151600A (en) * 1998-11-17 2000-06-05 Curagen Corporation Nucleic acids containing single nucleotide polymorphisms and methods of use thereof
US7179638B2 (en) 1999-07-30 2007-02-20 Large Scale Biology Corporation Microarrays and their manufacture by slicing
US6713309B1 (en) 1999-07-30 2004-03-30 Large Scale Proteomics Corporation Microarrays and their manufacture
WO2001038586A2 (en) * 1999-11-24 2001-05-31 Curagen Corporation Nucleic acids containing single nucleotide polymorphisms and methods of use thereof
WO2001048245A2 (en) * 1999-12-27 2001-07-05 Curagen Corporation Nucleic acids containing single nucleotide polymorphisms and methods of use thereof
CA2395607A1 (en) * 2000-01-07 2001-07-19 Curagen Corporation Nucleic acids containing single nucleotide polymorphisms and methods of use thereof
US20060228721A1 (en) 2005-04-12 2006-10-12 Leamon John H Methods for determining sequence variants using ultra-deep sequencing
CA2604095A1 (en) 2005-04-12 2006-10-19 454 Life Sciences Corporation Methods for determining sequence variants using ultra-deep sequencing
JP2010521156A (en) 2007-03-16 2010-06-24 454 ライフ サイエンシーズ コーポレイション System and method for detection of HIV drug resistant variants

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5206137A (en) * 1988-09-08 1993-04-27 Lifecodes Corporation Compositions and methods useful for genetic analysis
US5292639A (en) * 1989-08-28 1994-03-08 Iowa State University Research Foundation, Inc. Association of bovine mitochondrial DNA with traits of economic importance
US5468610A (en) * 1991-05-29 1995-11-21 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Three highly informative microsatellite repeat polymorphic DNA markers

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5206137A (en) * 1988-09-08 1993-04-27 Lifecodes Corporation Compositions and methods useful for genetic analysis
US5292639A (en) * 1989-08-28 1994-03-08 Iowa State University Research Foundation, Inc. Association of bovine mitochondrial DNA with traits of economic importance
US5468610A (en) * 1991-05-29 1995-11-21 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Three highly informative microsatellite repeat polymorphic DNA markers

Non-Patent Citations (11)

* Cited by examiner, † Cited by third party
Title
Cappellini, Maria Domenica et al., "Multiple G6PD Mutations Are Associated With a Clinical and Biochemical Phenotype Similar to That of G6PD Mediterranean", Blood, vol. 87, (May 1, 1996) No. 9, pp. 3953-3958.
Cappellini, Maria Domenica et al., Multiple G6PD Mutations Are Associated With a Clinical and Biochemical Phenotype Similar to That of G6PD Mediterranean , Blood, vol. 87, (May 1, 1996) No. 9, pp. 3953 3958. *
Chen et al., "Long-range sequence analysis in uman chromosome Xq28: thirteen known and six candidate genes in 219.4 kb of high GC DNA between the RCP/GCP and G6PD loci," Hum. Mol. Genet. vol. 5, no. 5, pp. 659-668; sequence comparison with Table 2 and, 1996.
Chen et al., Long range sequence analysis in uman chromosome Xq28: thirteen known and six candidate genes in 219.4 kb of high GC DNA between the RCP/GCP and G6PD loci, Hum. Mol. Genet. vol. 5, no. 5, pp. 659 668; sequence comparison with Table 2 and, 1996. *
Fan, Jian Bing et al., Screening the Human Genome for Single nucleotide Polymorphisms by Hybridization to High density Oligonucleotide Arrays , Mutation Detection 97, 4th International Workshop, (May 29 Jun. 2, 1997) 1 page. *
Fan, Jian-Bing et al., "Screening the Human Genome for Single-nucleotide Polymorphisms by Hybridization to High-density Oligonucleotide Arrays", Mutation Detection '97, 4th International Workshop, (May 29-Jun. 2, 1997) 1 page.
Kwok, Pui Yan et al., Increasing the Information Content of STS Based Genome Maps: Identifying Polymorphisms in Mapped STSs , Genomics, (1996) vol. 31, Article No. 0019, pp. 123 126. *
Kwok, Pui-Yan et al., "Increasing the Information Content of STS-Based Genome Maps: Identifying Polymorphisms in Mapped STSs", Genomics, (1996) vol. 31, Article No. 0019, pp. 123-126.
Nierman and Maglott, eds., ATCC/NIH Repository Catalogue of Human and Mouse DNA Probes and Libraries, Eighth edition, pp. 1 70., 1989. *
Nierman and Maglott, eds., ATCC/NIH Repository Catalogue of Human and Mouse DNA Probes and Libraries, Eighth edition, pp. 1-70., 1989.
Sigma Molecular Biology catalog, p. 54., 1989. *

Cited By (122)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6589726B1 (en) 1991-09-04 2003-07-08 Metrigen, Inc. Method and apparatus for in situ synthesis on a solid support
US7094609B2 (en) 1996-09-20 2006-08-22 Burstein Technologies, Inc. Spatially addressable combinatorial chemical arrays in encoded optical disk format
US6406857B1 (en) 1997-06-16 2002-06-18 Exact Sciences Corporation Methods for stool sample preparation
US6268136B1 (en) 1997-06-16 2001-07-31 Exact Science Corporation Methods for stool sample preparation
US6596509B1 (en) 1998-07-10 2003-07-22 Cornell Research Foundation, Inc. Recombinant constructs and systems for secretion of proteins via type III secretion systems
US6986987B1 (en) * 1998-07-24 2006-01-17 The Uab Research Foundation Genetic polymorphism in the receptor for IgA
US20100130368A1 (en) * 1998-07-30 2010-05-27 Shankar Balasubramanian Method and system for sequencing polynucleotides
US20040106110A1 (en) * 1998-07-30 2004-06-03 Solexa, Ltd. Preparation of polynucleotide arrays
US6703228B1 (en) 1998-09-25 2004-03-09 Massachusetts Institute Of Technology Methods and products related to genotyping and DNA analysis
US20040203032A1 (en) * 1998-09-28 2004-10-14 Whitehead Institute For Biomedical Research Pre-selection and isolation of single nucleotide polymorphisms
US20030022207A1 (en) * 1998-10-16 2003-01-30 Solexa, Ltd. Arrayed polynucleotides and their use in genome analysis
US20030224413A1 (en) * 1998-11-17 2003-12-04 Shimkets Richard A. Nucleic acids containing single nucleotide polymorphisms and methods of use thereof
US6670464B1 (en) 1998-11-17 2003-12-30 Curagen Corporation Nucleic acids containing single nucleotide polymorphisms and methods of use thereof
US6551777B1 (en) 1999-02-25 2003-04-22 Exact Sciences Corporation Methods for preserving DNA integrity
US20100173320A1 (en) * 1999-04-09 2010-07-08 Genzyme Corporation Methods for Detecting Nucleic Acids Indicative of Cancer
US6964846B1 (en) 1999-04-09 2005-11-15 Exact Sciences Corporation Methods for detecting nucleic acids indicative of cancer
US20050227249A1 (en) * 1999-07-30 2005-10-13 Ulrich Brinkmann Polymorphisms in the human MDR-1 gene and their use in diagnostic and therapeutic applications
US7811757B2 (en) 1999-09-08 2010-10-12 Genzyme Corporation Methods for disease detection
US6586177B1 (en) 1999-09-08 2003-07-01 Exact Sciences Corporation Methods for disease detection
US6849403B1 (en) 1999-09-08 2005-02-01 Exact Sciences Corporation Apparatus and method for drug screening
US20070202513A1 (en) * 1999-09-08 2007-08-30 Exact Sciences Corporation Methods for disease detection
US20030100102A1 (en) * 1999-09-16 2003-05-29 Rothberg Jonathan M. Apparatus and method for sequencing a nucleic acid
US7335762B2 (en) 1999-09-16 2008-02-26 454 Life Sciences Corporation Apparatus and method for sequencing a nucleic acid
US7264929B2 (en) 1999-09-16 2007-09-04 454 Life Sciences Corporation Method of sequencing a nucleic acid
US7244559B2 (en) 1999-09-16 2007-07-17 454 Life Sciences Corporation Method of sequencing a nucleic acid
US7211390B2 (en) 1999-09-16 2007-05-01 454 Life Sciences Corporation Method of sequencing a nucleic acid
US20040248161A1 (en) * 1999-09-16 2004-12-09 Rothberg Jonathan M. Method of sequencing a nucleic acid
US20020012930A1 (en) * 1999-09-16 2002-01-31 Rothberg Jonathan M. Method of sequencing a nucleic acid
US20030148344A1 (en) * 1999-09-16 2003-08-07 Rothberg Jonathan M. Method of sequencing a nucleic acid
US6784982B1 (en) 1999-11-04 2004-08-31 Regents Of The University Of Minnesota Direct mapping of DNA chips to detector arrays
US7145645B2 (en) 1999-11-04 2006-12-05 Regents Of The University Of Minnesota Imaging of biological samples using electronic light detector
US20020018199A1 (en) * 1999-11-04 2002-02-14 Martin Blumenfeld Imaging of biological samples using electronic light detector
US20030151735A1 (en) * 1999-11-04 2003-08-14 Martin Blumenfeld Scanning of biological samples
US6867851B2 (en) 1999-11-04 2005-03-15 Regents Of The University Of Minnesota Scanning of biological samples
US20040043467A1 (en) * 1999-12-07 2004-03-04 Shuber Anthony P. Supracolonic aerodigestive neoplasm detection
US6919174B1 (en) 1999-12-07 2005-07-19 Exact Sciences Corporation Methods for disease detection
US7368233B2 (en) 1999-12-07 2008-05-06 Exact Sciences Corporation Methods of screening for lung neoplasm based on stool samples containing a nucleic acid marker indicative of a neoplasm
US20080248471A1 (en) * 1999-12-07 2008-10-09 Shuber Anthony P Methods for disease detection
US20080254547A1 (en) * 1999-12-07 2008-10-16 Shuber Anthony P Supracolonic aerodigestive neoplasm detection
US7981612B2 (en) 1999-12-07 2011-07-19 Mayo Foundation For Medical Education And Research Methods of screening for supracolonic neoplasms based on stool samples containing a nucleic acid marker indicative of a neoplasm
US20030064372A1 (en) * 2000-06-22 2003-04-03 Bodnar Jackie S. Gene and sequence variation associated with lipid disorder
US20040053260A1 (en) * 2000-07-24 2004-03-18 Gut Glynne Ivo Method for haplotyping by mass spectrometry
WO2002016625A2 (en) 2000-08-25 2002-02-28 Basf Plant Science Gmbh Plant polynucleotides encoding prenyl proteases
US20080319179A1 (en) * 2000-10-06 2008-12-25 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US10407459B2 (en) 2000-10-06 2019-09-10 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US9133511B2 (en) 2000-10-06 2015-09-15 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US10669577B2 (en) 2000-10-06 2020-06-02 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US10669582B2 (en) 2000-10-06 2020-06-02 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US10662472B2 (en) 2000-10-06 2020-05-26 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US9708358B2 (en) 2000-10-06 2017-07-18 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US8088575B2 (en) 2000-10-06 2012-01-03 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US10648028B2 (en) 2000-10-06 2020-05-12 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US9719139B2 (en) 2000-10-06 2017-08-01 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US9718852B2 (en) 2000-10-06 2017-08-01 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US20080131895A1 (en) * 2000-10-06 2008-06-05 Jingyue Ju Massive parallel method for decoding DNA and RNA
US10633700B2 (en) 2000-10-06 2020-04-28 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US9725480B2 (en) 2000-10-06 2017-08-08 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US9868985B2 (en) 2000-10-06 2018-01-16 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US10577652B2 (en) 2000-10-06 2020-03-03 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US10407458B2 (en) 2000-10-06 2019-09-10 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US10570446B2 (en) 2000-10-06 2020-02-25 The Trustee Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US7790869B2 (en) 2000-10-06 2010-09-07 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US10457984B2 (en) 2000-10-06 2019-10-29 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US10435742B2 (en) 2000-10-06 2019-10-08 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US10428380B2 (en) 2000-10-06 2019-10-01 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US7713698B2 (en) 2000-10-06 2010-05-11 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
WO2002064612A2 (en) 2001-02-09 2002-08-22 Human Genome Sciences, Inc. Human g-protein chemokine receptor (ccr5) hdgnr10
US20030224365A1 (en) * 2001-04-24 2003-12-04 Wood Linda Susan Single nucleotide polymorphisms diagnostic for schizophrenia
US20030170667A1 (en) * 2001-08-28 2003-09-11 Kaytes Paul S. Single nucleotide polymorphisms diagnostic for schizophrenia
US20040115699A1 (en) * 2001-08-28 2004-06-17 Kaytes Paul S. Single nucleotide polymorphisms diagnostic for schizophrenia
US20030170679A1 (en) * 2001-11-09 2003-09-11 Wood Linda Susan Single nucleotide polymorphisms in GH-1
US7776524B2 (en) 2002-02-15 2010-08-17 Genzyme Corporation Methods for analysis of molecular events
US8409829B2 (en) 2002-02-15 2013-04-02 Esoterix Genetic Laboratories, Llc Methods for analysis of molecular events
US20080019958A1 (en) * 2003-01-21 2008-01-24 Bristol-Myers Squibb Company Polynucleotide encoding a novel acyl coenzyme a, monoacylglycerol acyltransferase-3 (mgat3), and uses thereof
US7259002B2 (en) 2003-01-21 2007-08-21 Bristol-Myers Squibb Company Polynucleotide encoding a novel acyl coenzyme A, monoacylglycerol acyltransferase-3 (MGAT3), and uses thereof
US20040223959A1 (en) * 2003-01-21 2004-11-11 Feder John N. Polynucleotide encoding a novel acyl coenzyme a, monoacylglycerol acyltransferase-3 (MGAT3), and uses thereof
US20070042433A1 (en) * 2003-03-26 2007-02-22 Jianxin Bao Neuregulin protein regulation of synaptic proteins
US20040259101A1 (en) * 2003-06-20 2004-12-23 Shuber Anthony P. Methods for disease screening
US7153666B2 (en) 2003-07-17 2006-12-26 General Atomics Methods and compositions for determination of glycated proteins
US20050014935A1 (en) * 2003-07-17 2005-01-20 Chong-Sheng Yuan Methods and compositions for determination of glycated proteins
US9447454B2 (en) 2003-10-23 2016-09-20 The Rockefeller University Method of purifying RNA binding protein-RNA complexes
US20080124714A1 (en) * 2004-05-14 2008-05-29 Exact Sciences Corporation Method for Stabilizing Biological Samples for Nucleic Acid Analysis
US20090162841A1 (en) * 2004-08-06 2009-06-25 Deutsches Krebsforschungszentrum Stifting Des Offentlichen Rechts Method of selecting a desired protein from a library
US7482124B2 (en) 2005-07-08 2009-01-27 Bristol-Myers Squibb Company Method of identifying a PPARgamma-agonist compound having a decreased likelihood of inducing dose-dependent peripheral edema
US20070009945A1 (en) * 2005-07-08 2007-01-11 Bristol-Myers Squibb Company Single nucleotide polymorphisms associated with dose-dependent edema and methods of use thereof
US20070202512A1 (en) * 2005-08-19 2007-08-30 Bristol-Myers Squibb Company Human single nucleotide polymorphisms associated with dose-dependent weight gain and methods of use thereof
US20080004209A1 (en) * 2006-06-30 2008-01-03 Bristol-Myers Squibb Company Method for identifying HIV-1 protease inhibitors with reduced metabolic affects
US7642049B2 (en) 2006-06-30 2010-01-05 Bristol-Myers Squibb Company Method for identifying HIV-1 protease inhibitors with reduced metabolic affects through detection of human resistin polymorphisms
EP2671946A1 (en) 2006-06-30 2013-12-11 Bristol-Myers Squibb Company Polynucleotides encoding novel PCSK9 variants
EP2639301A2 (en) 2006-06-30 2013-09-18 Bristol-Myers Squibb Company Polynucleotides encoding novel PCSK9 variants
US7598029B2 (en) 2006-06-30 2009-10-06 Bristol-Myers Squibb Company Method for identifying HIV-1 protease inhibitors with reduced metabolic affects
WO2008105797A2 (en) 2006-06-30 2008-09-04 Bristol-Myers Squibb Company Polynucleotides encoding novel pcsk9 variants
US8338184B2 (en) 2006-07-25 2012-12-25 General Atomics Methods for assaying percentage of glycated hemoglobin
US20110189712A1 (en) * 2006-07-25 2011-08-04 General Atomics Methods for assaying percentage of glycated hemoglobin
US20080096230A1 (en) * 2006-07-25 2008-04-24 Chong-Sheng Yuan Methods for assaying percentage of glycated hemoglobin
US7943385B2 (en) 2006-07-25 2011-05-17 General Atomics Methods for assaying percentage of glycated hemoglobin
US8318501B2 (en) 2006-07-25 2012-11-27 General Atomics Methods for assaying percentage of glycated hemoglobin
US20080299597A1 (en) * 2006-07-25 2008-12-04 Chong-Sheng Yuan Methods for assaying percentage of glycated hemoglobin
US7855079B2 (en) 2006-07-25 2010-12-21 General Atomics Methods for assaying percentage of glycated hemoglobin
US8557591B2 (en) 2006-07-25 2013-10-15 General Atomics Methods for assaying percentage of glycated hemoglobin
US9528151B2 (en) 2006-12-01 2016-12-27 The Trustees Of Columbia University In The City Of New York Four-color DNA sequencing by synthesis using cleavable fluorescent nucleotide reversible terminators
US8298792B2 (en) 2006-12-01 2012-10-30 The Trustees Of Columbia University In The City Of New York Four-color DNA sequencing by synthesis using cleavable fluorescent nucleotide reversible terminators
US11098353B2 (en) 2006-12-01 2021-08-24 The Trustees Of Columbia University In The City Of New York Four-color DNA sequencing by synthesis using cleavable fluorescent nucleotide reversible terminators
US11939631B2 (en) 2006-12-01 2024-03-26 The Trustees Of Columbia University In The City Of New York Four-color DNA sequencing by synthesis using cleavable fluorescent nucleotide reversible terminators
US20110020797A1 (en) * 2007-02-09 2011-01-27 Bristol-Myers Squibb Company Methods For Identifying Patients With An Increased Likelihood Of Responding To DPP-IV Inhibitors
US20110014611A1 (en) * 2007-10-19 2011-01-20 Jingyue Ju Design and synthesis of cleavable fluorescent nucleotides as reversible terminators for dna sequences by synthesis
US11242561B2 (en) 2007-10-19 2022-02-08 The Trustees Of Columbia University In The City Of New York DNA sequencing with non-fluorescent nucleotide reversible terminators and cleavable label modified nucleotide terminators
US10260094B2 (en) 2007-10-19 2019-04-16 The Trustees Of Columbia University In The City Of New York DNA sequencing with non-fluorescent nucleotide reversible terminators and cleavable label modified nucleotide terminators
US10144961B2 (en) 2007-10-19 2018-12-04 The Trustees Of Columbia University In The City Of New York Synthesis of cleavable fluorescent nucleotides as reversible terminators for DNA sequencing by synthesis
US9670539B2 (en) 2007-10-19 2017-06-06 The Trustees Of Columbia University In The City Of New York Synthesis of cleavable fluorescent nucleotides as reversible terminators for DNA sequencing by synthesis
US9175342B2 (en) 2007-10-19 2015-11-03 The Trustees Of Columbia University In The City Of New York Synthesis of cleavable fluorescent nucleotides as reversible terminators for DNA sequencing by synthesis
US12180544B2 (en) 2007-10-19 2024-12-31 The Trustees Of Columbia University In The City Of New York Synthesis of cleavable fluorescent nucleotides as reversible terminators for DNA sequencing by synthesis
US9115163B2 (en) 2007-10-19 2015-08-25 The Trustees Of Columbia University In The City Of New York DNA sequence with non-fluorescent nucleotide reversible terminators and cleavable label modified nucleotide terminators
US11208691B2 (en) 2007-10-19 2021-12-28 The Trustees Of Columbia University In The City Of New York Synthesis of cleavable fluorescent nucleotides as reversible terminators for DNA sequencing by synthesis
US20100025264A1 (en) * 2008-05-13 2010-02-04 Chong-Sheng Yuan Electrochemical biosensor for direct determination of percentage of glycated hemoglobin
US8673646B2 (en) 2008-05-13 2014-03-18 General Atomics Electrochemical biosensor for direct determination of percentage of glycated hemoglobin
US20110152340A1 (en) * 2008-05-16 2011-06-23 Bristol-Myers Squibb Company Methods for Identifying Subjects With an Increased Likelihood of Responding to DPP-IV Inhibitors
EP2993239A1 (en) 2008-05-16 2016-03-09 AstraZeneca AB Methods for identifying subjects with an increased likelihood of responding to dpp-iv inhibitors
US10648026B2 (en) 2013-03-15 2020-05-12 The Trustees Of Columbia University In The City Of New York Raman cluster tagged molecules for biological imaging
US11059968B2 (en) 2017-02-28 2021-07-13 Toyobo Co., Ltd. Polyester elastomer resin composition having improved mold fouling
US11610647B2 (en) * 2017-10-18 2023-03-21 Centre National De La Recherche Scientifique (Cnrs) Method and system for generating a unique identifier of a subject from the DNA of said subject
US20210193256A1 (en) * 2017-10-18 2021-06-24 Centre National De La Recherche Scientifique (Cnrs) Method and system for generating a unique identifier of a subject from the dna of said subject

Also Published As

Publication number Publication date
AU5155498A (en) 1998-05-22
WO1998018967A1 (en) 1998-05-07

Similar Documents

Publication Publication Date Title
US5856104A (en) Polymorphisms in the glucose-6 phosphate dehydrogenase locus
EP0941366A2 (en) Biallelic markers
EP0955382A2 (en) Polymorphisms associated with hypertension
WO1998038846A2 (en) Genetic compositions and methods
US6869762B1 (en) Crohn's disease-related polymorphisms
US20060188875A1 (en) Human genomic polymorphisms
US20020037508A1 (en) Human single nucleotide polymorphisms
WO2001066800A2 (en) Human single nucleotide polymorphisms
EP0812922A2 (en) Polymorphisms in human mitochondrial nucleic acid
US20030162192A1 (en) Polymorphisms associated with ion-channel disease
EP1240354A2 (en) Single nucleotide polymorphisms in genes
WO1999050454A2 (en) Coding sequence polymorphisms in vascular pathology genes
WO1998058529A2 (en) Genetic compositions and methods
WO2000058519A2 (en) Charaterization of single nucleotide polymorphisms in coding regions of human genes
US6833240B2 (en) Very low density lipoprotein receptor polymorphisms and uses therefor
US20030039973A1 (en) Human single nucleotide polymorphisms
US20030054381A1 (en) Genetic polymorphisms in the human neurokinin 1 receptor gene and their uses in diagnosis and treatment of diseases
EP1068354A2 (en) Biallelic markers
WO1999014228A1 (en) Genetic compositions and methods
EP1276899A2 (en) Ibd-related polymorphisms
WO2001038576A2 (en) Human single nucleotide polymorphisms
EP1024200A2 (en) Genetic compositions and methods
US20030008301A1 (en) Association between schizophrenia and a two-marker haplotype near PILB gene
WO2001034840A2 (en) Genetic compositions and methods
US20030232365A1 (en) BDNF polymorphisms and association with bipolar disorder

Legal Events

Date Code Title Description
AS Assignment

Owner name: AFFYMETRIX, INC., CALIFORNIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:CHEE, MARK;FAN, JIAN-BING;REEL/FRAME:008664/0426

Effective date: 19970721

AS Assignment

Owner name: AFFYMETRIX, INC., CALIFORNIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:CHEE, MARK;REEL/FRAME:009552/0600

Effective date: 19980721

STCF Information on status: patent grant

Free format text: PATENTED CASE

AS Assignment

Owner name: AFFYMETRIX, INC., A DELAWARE CORPORATION, CALIFORN

Free format text: MERGER;ASSIGNOR:AFFYMETRIX, INC., A CALIFORNIA CORPORATION;REEL/FRAME:009748/0134

Effective date: 19980929

FPAY Fee payment

Year of fee payment: 4

FPAY Fee payment

Year of fee payment: 8

FPAY Fee payment

Year of fee payment: 12

AS Assignment

Owner name: GENERAL ELECTRIC CAPITAL CORPORATION, AS AGENT, MA

Free format text: SECURITY AGREEMENT;ASSIGNOR:AFFYMETRIX, INC.;REEL/FRAME:028465/0541

Effective date: 20120625

AS Assignment

Owner name: BANK OF AMERICA, N.A., AS ADMINISTRATIVE AGENT, TE

Free format text: SECURITY INTEREST;ASSIGNOR:AFFYMETRIX, INC.;REEL/FRAME:036988/0166

Effective date: 20151028

AS Assignment

Owner name: AFFYMETRIX, INC., CALIFORNIA

Free format text: RELEASE BY SECURED PARTY;ASSIGNOR:GENERAL ELECTRIC CAPITAL CORPORATION, AS AGENT;REEL/FRAME:037109/0132

Effective date: 20151028

AS Assignment

Owner name: AFFYMETRIX, INC., CALIFORNIA

Free format text: NOTICE OF RELEASE;ASSIGNOR:BANK OF AMERICA, N.A.;REEL/FRAME:038361/0891

Effective date: 20160328

OSZAR »